1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
3 years ago
10

Angle b measures 60 what is the measure of the angle that is complementary to angle b ?

Mathematics
2 answers:
AleksAgata [21]3 years ago
7 0

Answer:

30°

Step-by-step explanation:

Complementary is they add up to 90°

90° - 60° = 30°

Kay [80]3 years ago
5 0

Answer:

30 degrees

Step-by-step explanation:

Complementary angles add up to 90 degrees.   Thus, 60 and (complementary angle) = 90 degrees.  Thus, the angle that is complementary to 60 degrees is 30 degrees.

You might be interested in
Find two sets of parametric equations for the rectangular equation. y=(x-6)^2-7x.
jekas [21]

The two sets of parametric equations for the rectangular equation are;

  • If x=t+6 then y= t²-7t-42.
  • If x=7t then y= 49t² - 133t +36.

<h3>What are the parametric equations from the rectangular equation?</h3>

It follows from the task content that the parametric equations can be determined as follows;

By substituting the x= t+6 into the rectangular equation; we have;

y = (t+6-6)²-7(t+6)

y = t²-7t-42.

By substituting the x= 7t into the rectangular equation; we have;

y = (7t-6)² -7(7t)

y = 49t² - 84t +36 - 49t

y = 49t² - 133t +36.

Read more on parametric equations from rectangular equations;

brainly.com/question/23312942

#SPJ1

5 0
2 years ago
Find the area of each trapewid.<br> 6 am<br> : 6 cm<br> - 10 cm-
myrzilka [38]
Just use Online free calculator
4 0
3 years ago
The letters of the word S U M M E R were placed in a bag. What is the probability of choosing an R?
lawyer [7]

。☆✼★ ━━━━━━━━━━━━━━  ☾  

There is only one R in the bag

So the probability would be 1/6

1/6 as a decimal is 0.16

Thus, your answer would be option D

Have A Nice Day ❤    

Stay Brainly! ヅ    

- Ally ✧    

。☆✼★ ━━━━━━━━━━━━━━  ☾

3 0
3 years ago
Mike said last week I ran 15 miles further than Bell. Pete said last week I ran 1 mile less than three times as far as Bill. If
disa [49]

Answer:

The distance cover by Bell is 8 miles .

Step-by-step explanation:

Given as :

The distance cover by Mike = The distance cover by Pete = D miles

Let The distance cover by Bell = d miles

The distance cover by Mike = 15 miles + distance cover by Bell

i.e D = 15 + d            ............1

Again

The distance cover by Pete = three time distance cover by Bell - 1 miles

i.e D = 3 × B - 1

Or, D = 3 d - 1           ............2

Now, Solving equation 1 and 2

So, 15 + d = 3 d - 1

Or, 3 d - d = 15 + 1

Or, 2 d = 16

∴   d = \dfrac{16}{2}

i.e d = 8 miles

So,The distance cover by Bell = d = 8 miles

Hence, The distance cover by Bell is 8 miles . Answer

6 0
2 years ago
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
sdas [7]

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

7 0
2 years ago
Other questions:
  • The Bread Alone Bakery has a daily overhead of
    5·1 answer
  • Using complete square to slove for x in the equation (x+7) (x-9)=25
    7·1 answer
  • Maria rotated the triangle 90 degrees clockwise about the origin. What is the new triangle?
    15·1 answer
  • Please help ASAP!
    13·1 answer
  • Use the substitution method to solve the system of equations. Choose the
    13·2 answers
  • Max delivers 8160 pieces of mail in one year. About how many pieces of mail does he deliever in 2 months
    6·2 answers
  • Name the radius of the circle:<br> B<br> F<br> Next<br> Mark For Review
    11·1 answer
  • What is the order of operations for evaluating expressions
    7·2 answers
  • In a raffle, 200 tickets are sold.
    13·2 answers
  • How can you tell which one it is?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!