1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dsp73
3 years ago
14

Which landforms go into which category? Fan, Dunes, Rockfall, Sea caves, sea stack, sandbar Gravity Wind Wave Action - - - - - -

-
Biology
1 answer:
Ivan3 years ago
5 0

Answer:

Sea caves

Explanation:

Sea caves is a land form that is formed in a cliff by the action of wave of the ocean or lakes. It is called littoral cave and mainly formed by wave action of a sea which involved the process of mechanical erosion and occur in clogged coast where there is break in the wave or wave action.

You might be interested in
Metano (CH4) puede regresar a la atmosfera como dioxido de carbono a traves del proceso de? Porfa ayuden es un examen >.
mel-nik [20]

Answer:

Combustión

Explanation:

La combustión es el proceso mediante el cual la materia reacciona con el oxígeno y se convierte en dióxido de carbono y agua.

Otro nombre para la combustión es quema. Cuando el metano se quema en el aire, se convierte en dióxido de carbono y se devuelve a la atmósfera según la reacción;

CH4 (g) + 2O2 (g) -----> CO2 (g) + 2H2O (g)

8 0
3 years ago
during a long race one athlete did not drink any liquid towards the end of the race the amount of sweat he produced began to fal
Daniel [21]

Answer:

He is starting to suffer from dehydration and heat exhaustion

Explanation:His body can no longer produce enough sweat to cool him down simply because of the fact that he did not drink any liquids but it is important he gets hydrated soon or he may need to go to the emergency room

6 0
3 years ago
A 29-year-old man presents with bizarre behavior and profuse sweating. his wife tells you that he has type 1 diabetes and that h
erica [24]
You'll most likely find out that his glucose levels have dropped.
8 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
2 years ago
How can you tell if an atom has a negative charge? What type of Ion is this?
Softa [21]
ANSWER: If the atom has more electrons than protons, it is a negative ion, or ANION. If it has more protons than electrons,it is a positive ion.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which spot delivers the greatest amount of energy to the floor
    15·1 answer
  • How do the bones, muscles and sensory organs work together?
    14·1 answer
  • True or False: Within the body, all atoms combine to form molecules. If false, why?
    8·1 answer
  • A paleontologist has recovered a bit of tissue from the 400-year-old preserved skin of an extinct dodo (a bird). To compare a sp
    8·1 answer
  • What is an organelle?
    9·2 answers
  • Which discovery best supports the hypothesis that evolution of the lactase-persistence trait was driven by dairying, the use of
    6·1 answer
  • Match the best description to the following terms:
    12·1 answer
  • Which of the following organisms make glucose and how? Question options: a) plants b) plants and fungi c) plants and animals d)
    11·1 answer
  • While waiting at an airport, Neil Campbell once overheard this claim: "It's paranoid and ignorant to worry about industry or agr
    11·1 answer
  • A bacterial cell is in a solution with a chemical gradient. The bacterial cell directs its movements in order to move toward the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!