Ask question

Ask question

All categories

2 years ago

9

Which statement best explains how a cyclone forms?

1 answer:

Drupady [299]2 years ago

4 0

A trust me brooooooooooo

You might be interested in

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0

2 years ago

Measuring Populations

Artyom0805 [142]

I think it is D
........

5 0

2 years ago

Our Sun is considered a(n) _____ star. A. small B. large C. giant D. average

Gala2k [10]

The sun is considered a giant star so C)

6 0

3 years ago

Read 2 more answers

What is the only place in cells where oxygen, enzyme, and food molecules can combine to release energy

tiny-mole [99]

Answer:

Cellular Resperarion

Explanation:

3 0

2 years ago

Read 2 more answers

Which type of gland produces hormones? which type of gland produces hormones? unicellular exocrine glands holocrine glands endoc

goblinko [34]

<span>Which type of gland produces hormones? which type of gland produces hormones? unicellular exocrine glands halocline glands endocrine glands multicellular exocrine glands? </span>

6 0

2 years ago