1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
2 years ago
7

Which commercial fishing technique has a low rate of bycatch?

Biology
1 answer:
Naddika [18.5K]2 years ago
4 0

Fishing rod

Explanation:

You might be interested in
3.
kicyunya [14]

Answer:

i have not a clue in the world lol

3 0
2 years ago
Robert, an aspiring scientist in a biology class, wanted to conduct a study on the effects of cigarette smoke on the web-buildin
Evgesh-ka [11]

Answer:

<em>The statement that is incorrect is :</em>

<em>Robert wanted to see if his theory was true that cigarette smoke will influence web-building in spiders.</em>

Explanation:

A theory can be described as a descriptive explanation of a phenomenon which is supported by valid experiments and careful examination of facts. As Robert, has not conducted any experiments nor has proved his study with reference to facts, hence it cannot be considered as a theory.

Robert wanted to see if his observation was true that cigarette smoke will influence web-building in spiders will be the correct statement that could be used.

5 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
A synthetic toxin destroys the myelin covering your optic nerves and motor neurons. what effect will the destruction of myelin s
Marizza181 [45]
Myelin sheaths, which cover the axon of the nerve cells in the brain and spinal
cord, prevents the electric current from dissipating from the axon.
 Destroying the <span>myelin sheaths impairs the conduction of signals on the affected nerves, causing damage in every function that the nerve is involved, in this case will affect movements and vision.</span>


8 0
3 years ago
Mitosis &amp; Meiosis: Thinking Scientifically
REY [17]

Answer:

65536 cells

Explanation:

starting from 1 cell at zero minutes  there will be 1 (2^0) cell; 2^0 = 1

after 15 minutes                    there will be 2 (2^1) cells

after another 15 minutes ( 30 min)        there will be 4 ( 2²) cells

after another 15 minutes ( 45 min)         there will be 8 (2³) cells

after n number of 15 minutes                  there will be (2^n) cells

calculate number of 15 minutes in 4 hours

4 hours = 4 × 60 minutes

number ( n) of 15 minutes in 4 hours = (4 × 60 minutes) / 15 minute = 16

using the formula above and substitute 16 for n in the formula

Number of cells = 2 ^n = 2^16 = 65536 cells

6 0
3 years ago
Other questions:
  • Which of the following is the primary cause of the rapid rise in loss of biodiversity?
    6·2 answers
  • Through which of the following do sperm cells travel to reach the urethra? Epididymis Vas deferens Penis Testes
    6·2 answers
  • Answer both questions pleadeee
    6·1 answer
  • What part of the cell regulates the movement of materials into and out of the cell
    12·1 answer
  • In humans, the hormone testosterone enters cells and binds to specific proteins, which in turn bind to specific sites on the cel
    5·1 answer
  • Translation consists of which of the following? a the conversion of genetic information from the language of nucleic acids to th
    7·1 answer
  • Which of these is a goal that a female might set for herself in order to
    9·1 answer
  • A stove feels hot because of heat transfer by.............<br><br> 1. Conduction<br> 2. Covection
    5·2 answers
  • What products are made from the process of photosynthesis
    14·2 answers
  • Adolescent may conform with peers out of fear of
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!