1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
6

How do the sizes of each population affect each other?

Biology
1 answer:
kirill115 [55]3 years ago
5 0
If one population dies out, all the populations that depend on that species for food may also die out. A change in one population affects the entire community because all the populations of a community depend on each other. A population is all the members of one type of organism living in an ecosystem.
You might be interested in
What is the composition and approximate thickness of the mantle?
vredina [299]
The mantle is very hot. Thickness is 2885km.
3 0
4 years ago
Read 2 more answers
What does aponeurosis means in anatomy?
Ksivusya [100]
<span>it means a sheet of white fibrous tissue that takes the place of a tendon</span>
6 0
3 years ago
In humans, one function of the skin is to prevent water loss. Skin releases water or holds in water when necessary.
AysviL [449]
It’s the cuticle and stomata. :)
3 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
A gene consists of which of the following?
nirvana33 [79]

Answer:

answer is part (4)

Explanation:

A sequence of bases on DNA that code for a specific protein

3 0
3 years ago
Other questions:
  • Which career combines DNA technology and medicine?
    10·2 answers
  • Which of the following is NOT true about light-independent photosynthesis? a. Light-independent reactions take the products of t
    8·1 answer
  • The mangrove tree is an important foundation species in estuarine and coastal forests. When mangrove trees are removed, it resul
    9·2 answers
  • The cytoplasm of the lower epidermal cells of the plant species Zebrina contains purple pigment. What is the advantage of using
    9·1 answer
  • 3. Living systems consist of organisms interacting with their environments. The carbon cycle is an example of a living system. A
    12·2 answers
  • Random chance is an important part of a simulation because it is a way to
    6·2 answers
  • How might a plant cope with the fact that the Calvin cycle uses more ATP than NADPH, yet produces roughly the same amount of bot
    5·1 answer
  • What other features of annelids appear in other phyla?
    5·1 answer
  • Choose an example of a protein that has quaternary structure
    6·1 answer
  • 5'AUGUUUUGCUACUAA3'<br> How many amino acids will be produced?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!