Prokaryotic also has cell walls but besides that everything you have is correct
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
The part of the nervous system that is used to help you think through situations is called the central.
Answer: Option C
<u>Explanation:</u>
The central nervous system comprises of the spinal cord and the brain. It is given the name as Central nervous system as it accelerates thinking and passes information. There are some important reflexes that mainly involve the spinal cord and central nervous system like thinking through the situations.
It controls our movements, thinking and acting. The central nervous system send signal from one cell to another cell. It gathers information from all over the body and transmits it to the other parts.
The answer is B Troposphere. The Troposphere is actually the lowest layer of atmosphere on the earth. The Lithosphere is the upper area of the Earth's solid layers.
The answer to the question is D
