1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lilavasa [31]
3 years ago
9

What are five individual food chains?

Biology
1 answer:
Zigmanuir [339]3 years ago
8 0
Here’s 5 individual food chains

1) Grass, Cow, Man, Maggot

2) Leaves, Ants, Anteaters

3) Nuts, Squirrels, Hawks

4) Rice, Rats, Owl

5) Sun, Grass, Ant, Echidna, Dingo

I hope it helps
You might be interested in
Complete the passage about the nitrogen cycle.
Gnesinka [82]

Answer:

During nitrogen fixation specialised bacteria living in the earth's atmosphere convert nitrogen taken from the geosphere

6 0
3 years ago
In your own words, explain why an earthworm cannot survive if it were cut in half. PLEASE HURRY​
Masja [62]
It cannot survive because an earth worm will not become 2 new worm. The head of the worm may survive and regenerate a tail. But if original tail of the worm may not survive because it will not be able to grow a new head or the rest of its vital organs and it will die. I hope this helps. :)
5 0
3 years ago
How do nerve cells form different types of tissues? A. A group of these cells perform similar functions and become nerve tissue
lions [1.4K]
It's letter c i believe, because they need the DNA's instruction on how to copy the exact tissue copy.
8 0
3 years ago
Portion of the meninges protrudes through the spinal canal wall is??
QveST [7]

Meningocele

Meningocele (MM) is known as meningeal cyst and it is the protrusion of the membrane that cover the part of spinal cord through the defect in the vertebral column. Thus, Meningocele (MM) is the least common fom of spinal bifida and spina bifida is the bony defect in the vertebral column through the meningeal membrane.

3 0
3 years ago
3c. explain what a codon is. include the words "nucleotides" and "amino acid" in your answer.
Harrizon [31]
Each combination of 3 nucleotides are called a codon. The codons then determine which amino acids are going to be inserted in the protein
5 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The differences between hashimotos' thyroiditis and grave's disease include
    5·2 answers
  • Look at the protons below. Which could be it's function?
    8·1 answer
  • Genes alone do not determine development; environmental forces also shape development. This information has led to the understan
    7·2 answers
  • What is nitrogen fixation
    15·1 answer
  • Which type of cell is pictured on the right?​
    5·2 answers
  • Please Help! Which material undergoes radioactive decay? A) all elements that have a half-life B) all elements that contain atom
    6·1 answer
  • What is the main purpose of controlled variables in an experiment?
    14·1 answer
  • Are organelle found in prokaryotes or eukaryote cells
    6·2 answers
  • What would happen if your heart valves stopped working?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!