1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
4 years ago
10

One function of the poly-A tail on eukaryotic MRNA sequences is to help the MRNA be transported from the nucleus to the cytoplas

m. Prokaryotic mRNA also has a poly-A tail. Choose the best explanation of the prokaryotic poly-A tail.
Biology
1 answer:
Alinara [238K]4 years ago
3 0

Answer:

In eukaryotes, it is well known that polyadenylation is required to produce the mature messenger RNA (mRNA) molecule and it provides stability to the mRNA during translation initiation. In prokaryotic organisms, polyadenylation is required for the degradation of the mRNA in a mechanism that involves three steps: endonucleolytic cleavage, polyadenylation and exonucleolytic degradation. Moreover, it is also important to note that no evidence of polyadenylation has bee reported in some prokaryotes including the halophilic bacteria Haloferax volcanic (Slomovic et al. 2005).

Citation:

Slomovic, S., Laufer, D., Geiger, D., & Schuster, G. (2005). Polyadenylation and degradation of human mitochondrial RNA: the prokaryotic past leaves its mark. Molecular and cellular biology, 25(15), 6427-6435.

You might be interested in
Explain why it is an advantage for plants to store carbohydrates as starch rather than as sugars​
Darina [25.2K]

Answer:

More energy are packed into less space by starch molecules far more than glucose or sucrose yet they are able to release this energy easily, hence maximizing both storage and mobilization.

Explanation:

When plants have a period of dormancy to survive, they store their food as starch. They store enough of this energy so as to be able to restart with and to be able to maintain metabolism for the entire period of dormancy.

In addition, we know that starch is not water soluble, hence, lacks the ability to pull water into storage cells or cause irregularity in water balance. More energy are packed into less space by starch molecules far more than glucose or sucrose yet they are able to release this energy easily, hence maximizing both storage and mobilization.

Glucose is not directly transported by plants to storage. Rather, in a plant stem, the form of carbohydrate being transported is sucrose and this is because it is a non-reducing and does not react with oxygen during transport in the stem to specialized storage plastids.

4 0
3 years ago
Jelaskan kesan pengglasieran terhadap bumi​
lesantik [10]
Dendjshzb lol....hahah
6 0
3 years ago
Which statement is true about using Parallax to measure the distance to Stars?
Naddika [18.5K]
The correct answer is letter B. the closer the star, the larger the Parallax angle. This is an illusion that is made through visual perspectives of observers of stars. A parallax can also be used to find the distance to the stars that are relatively close. 
6 0
4 years ago
Read 2 more answers
All of the following factors are responsible for unloading of oxygen from the hemoglobin molecule except
tatuchka [14]

All of the factors are responsible for unloading of oxygen from the hemoglobin molecule except the increase in partial pressure of oxygen.

Because the affinity of haemoglobin for binding oxygen increases as  partial pressure of oxygen rises.

<h3>What is  Haemoglobin?</h3>

Red blood cells include the protein hemoglobin, which transports oxygen to your body's organs and tissues and carbon dioxide from those tissues back to your lungs.

<h3>What are factors that affect Haemoglobin's affinity for oxygen?</h3>
  • When used as an oxygen transporter, hemoglobin can carry about 65 times as much oxygen as simple solution in plasma could.
  • A cooperative oxygen-hemoglobin affinity is produced by conformational changes in the molecule.
  • The oxygen-hemoglobin dissociation curve's sigmoidal form reflects this characteristic.
  • Temperature, hydrogen ions, carbon dioxide, and intraerythrocytic 2,3-DPG all have an impact on hemoglobin's affinity, and they all interact with one another.

Learn more about Haemoglobin here:

brainly.com/question/28135307

#SPJ4

6 0
1 year ago
Wernicke's area is associated with a. reflex centers for controlling heartbeat. b. sexual arousal. c. the ability to ride a bike
olga2289 [7]
E- the ability to speak
3 0
3 years ago
Other questions:
  • Which is NOT an energy type?
    12·1 answer
  • PLZ HURRY I HAVE TO FINISH MY HOMEWORK IF I WANT TO GO HORSEBACK RIDING TOMORROW
    8·2 answers
  • In the oceans the colder water sinks into deep basins, while warmer water stays closer to the surface. The water then moves arou
    5·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following must be true in a dry limestone cave? Select all that apply. A. Water once entered the cave. B. The cave
    10·1 answer
  • What is the powerhouse of the cell. i give brainliest
    14·2 answers
  • Hey guys whats up hows it going
    13·1 answer
  • How do scientist collect data?
    12·1 answer
  • What type of light (energy) does each light start out as?
    8·1 answer
  • Among the invertebrate phyla, phylum arthropoda is unique in possessing members that have.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!