1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
3 years ago
7

Pls help (ASASP)

Biology
2 answers:
gogolik [260]3 years ago
4 0
Sponge ? i may be wrong though
kipiarov [429]3 years ago
3 0

Answer:

whales I maybe wrong

Explanation:

You might be interested in
Newton's third law of motion states that for every action there is an equal and opposite reaction. Science teachers often model
Shkiper50 [21]

Answer:

The law is an abstract idea that may be difficult to understand without seeing how it works.

Explanation:

5 0
3 years ago
Read 2 more answers
Ayuda, no puedo resolver esto
Roman55 [17]

Answer:

is this Spanish or no i don't know

3 0
3 years ago
The Grand Canyon was carved out by the Colorado River. This caused the separation of members of a squirrel species. Abert’s Squi
Marta_Voda [28]

Answer:

D. geographic isolation.

Explanation:

As the Grand Canyon formed, it became a physical barrier to the mixing of squirrels from its northern and southern sides. Each squirrel population was confined to a single side. This type of separation is referred to as geographic isolation.

3 0
3 years ago
Pls, I need help with this! Biology Thank you :)
topjm [15]

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

8 0
3 years ago
Is cali good for lavender plants and why ?
Crazy boy [7]
Yeah it is because it helps it live longer then planned
8 0
3 years ago
Other questions:
  • Osmoregulators have _____ internal solute concentrations compared to their external environment.
    13·2 answers
  • Explain why some types of magma form igneous rocks that are dark colored and dense.
    9·2 answers
  • During which of the following investigations would a lab journal be a valuable tool?
    8·1 answer
  • When measuring the weight of individuals in a population of ground squirrels, what tools would be most appropriate
    12·1 answer
  • Phospholipid bilayer
    11·1 answer
  • In the semi arid region of China the country inhabitants have practiced water harvesting for generation water harvesting is the
    15·1 answer
  • The options are: ecosystem, population, food web, or niche
    6·1 answer
  • If a city is experiencing very high temperatures, what action would allow the city to become
    15·1 answer
  • Why do points on earth travel at different speeds?
    10·1 answer
  • During which phase of meiosis do spindle fibers move the sister chromatids to the center of the cells?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!