1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allisa [31]
3 years ago
6

What formula was used to find the answer

Chemistry
1 answer:
Setler79 [48]3 years ago
6 0
Can you give more information?
You might be interested in
Which type of atom has the strongest attraction for electrons in bond formation? barium (Ba) chlorine (Cl) iodine (I) strontium
bezimeni [28]

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.
The type of atom has the strongest attraction for electrons in bond formation Chlorine (Ci) c<span>onsider the location of barium, chlorine, iodine, and strontium on the periodic table.</span>
6 0
4 years ago
Read 2 more answers
a) Calculatethe molality, m, of an aqueous solution of 1.22 M sucrose, C12H22O11. The density of the solution is 1.12 g/mL.b) Wh
Contact [7]

Answer:

a) 1,74 molal

b) 37,2 %

c) 0,03

Explanation:

We are going to define sucrose as solute, water as solvent and the mix of both, the solution.

Let´s start with the data:

Molarity = M = \frac{1,22 mol solute}{lts solution}

We can assume as a calculus base, 1 liter of solution. So, in 1 liter of solution we have 1,22 moles of solute:

1 lts solution * \frac{1,22 moles solute}{lts solution}=1,22 moles solute

Knowing that the molality (m) is defined as mol of solute/kgs solvent, we have to calculate the mass of solvent on the solution. Remember our calculus base (1 lts of solution). In 1 lts of solution we have 1120 grams of solution.

1 lts solution * \frac{1,12 grs solution}{mL solution}*\frac{1000 mL solution}{1 lts solution} = 1120 grs of solution

With the molecular weight of solute (<em>Sum of: for carbon = 12*12=144; for hydrogen = 1*22=22 and for oxygen = 16*11=176. Final result = 342 grs per mol</em>), we can obtain the mass of solute:

1,22 mol solute*\frac{342 grs solute}{1 mol solute} = 417,24 grs solute

Now, the mass of solvent is: mass solvent = mass of solution - mass of solute. So, we have: 1120 - 417,24 = 702,76 grs of solvent = 0,70276 Kgs of solvent

molality = m = \frac{1,22 mol solute}{0,70276 kgs solvent}= 1,74 molal

For b) question we have that the mass percent of solute is hte ratio between the mass of solute and the mass of solution. So,

%(w/w) = \frac{417,24 grs solute}{1120 grs solution} = 37,2%

For c) question we have that the mole fraction of solute is the ratio between moles of solute and moles of solution. Let's calculate the moles of solution as follows: <em>Moles solution = moles solute + moles solvent.</em> First we have that the moles of solvent are (remember that the molecular weight of water for this calculus is 18 grs per mol):

702,76 grs solvent*\frac{1 mol solvent}{18 grs solvent} = 39,04 moles solvent  

So, we have the moles of solution: 1,22 moles of solute + 39,04 moles of solvent = 40,26 moles of solution

Finally, we have:

Mol frac solute = \frac{1,22 mol solute}{40,26 mol solution}= 0,03

6 0
3 years ago
Why do the pH scale generally range from 0 to 14 in aqueous solution?
zalisa [80]

Answer:

In aqueous solution the pH scale varies from 0 to 14, which indicates this concentration of hydrogen. Solutions with pH less than 7 are acidic (the value of the exponent of the concentration is higher, because there are more ions in the solution) and alkaline (basic) those with a pH higher than 7. If the solvent is pure water, the pH = 7 indicates neutrality of the solution

Explanation:

PH is a measure of how acidic or basic a liquid is. Specifically, from a dissolution. The acidity of a solution is essentially due to the concentration of hydrogen ions dissolved in it. In reality, the ions are not found alone, but are in the form of hydronium ions consisting of one oxygen molecule and three positively charged hydrogen. PH precisely measures this concentration. And to do it, we can use simple and very visual methods.

5 0
3 years ago
Which salt is formed by the reaction between hydrochloric acid and sodium hydroxide, write with chemical equation. .​
stepan [7]

Answer:

salt sodium chloride (NaCl)

8 0
3 years ago
4. Traditional bomb calorimetry can be used to find the energy content of food. Why is it
VladimirAG [237]

Answer:

B. it accounts for all the energy in the good even if some of its largely excreted by th body

3 0
3 years ago
Other questions:
  • A gas mixture called heliox, 6.11% o2 and 93.89% he by mass, is used in scuba tanks for descents more than 65 m below the surfac
    12·2 answers
  • Help with chemistry homework. Awards for best and first answer.<br> Please label answer a and b
    9·1 answer
  • PLS ANSWER!!!!
    11·1 answer
  • what is the volume of 24.0 g of oxygen gas at stp? i need to show work and i just cant get it. please help?
    15·1 answer
  • Explain why the temperature of water might increase when a solution forms
    6·1 answer
  • Calculate q, the heat released in each reaction.
    14·1 answer
  • Washing soda is a hydrate of sodium carbonate. Elemental analysis of a sample of washing soda gave 4.20% C and 7.05% H. What is
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How long would it take to reduce 1 mole of each of the following ions using the current indicated? Assume the voltage is suffici
    7·1 answer
  • In a particular redox reaction, no−2no2− is oxidized to no−3no3− and fe3 fe3 is reduced to fe2 fe2. complete and balance the equ
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!