1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
3 years ago
13

Which statement describes the structure of lipids?

Biology
1 answer:
iren2701 [21]3 years ago
6 0

Answer:

composed of a glycerol molecule binded to fatty acid molecules

Explanation:

You might be interested in
What would be the effect on blood flow if some arteries lost their elasticity?
viktelen [127]

c because the elasticity of arteries allow them to expand and contain more blood in them.

Hope this helps :)

3 0
3 years ago
Can somebody help me with this problem
Leya [2.2K]
The answer to this should be nutrition and health. The reason is if you have great nutrition and health your hair will growvand be healthy

Hope this helped :)
Have a great day
5 0
3 years ago
What is a microscope​
Kazeer [188]

Answer:

an optical instrument used for viewing very small objects, such as mineral samples or animal or plant cells, typically magnified several hundred times.A microscope is a laboratory instrument used to examine objects that are too small to be seen by the naked eye. Microscopy is the science of investigating small objects and structures using a microscope. Microscopic means being invisible to the eye unless aided by a microscope.

4 0
3 years ago
Barnacles attach to shellfish for transportation. The shellfish is not helped or harmed. This is an example of_
Vesna [10]

The correct answer is:

_________________________________________________

                       →    " commensalism" .

_________________________________________________

<u>Note</u>: "Commensalism" refers to a symbiotic relationship {"symbiosis"}  between two (2) organisms — in which one organism benefits and the other organism is neither helped nor harmed.  

              { i.e.  " +, 0 " ;  that is:  "plus" sign for "one organism benefits" ;

                       "zero" sign for "neutral" ;

                    (in that the other organism is neither helped nor harmed.}.

_________________________________________________

In the example given in the question, the two (2) organisms are:

 1)  the barnacles;  and:  2)  the shellfish.

       The barnacles benefits by given a place to attach for the purpose of transportation (by using the shellfish to "cling to"}.  

      The shellfish are neither helped (benefitted in anyways from the attachment from the barnacles— nor are the shellfish harmed in any way.

_________________________________________________

Hope this answer helps you!

     Best wishes in you academic pursuits

               — and within the "Brainly" community!

__________________________________________________

8 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • in pea plants tall is dominant over short. What us the phentoype of a cross between two heterozygous tall pea plants
    8·1 answer
  • Researchers are working to develop biofuels to free us from dependence on fossil fuels. Based on what you know about cellulose,
    12·1 answer
  • Which of the following factors does not influence the level of the water table?
    6·1 answer
  • This solution has 80% solute concentration inside the cell, and 20% outside what is it?
    7·1 answer
  • The almost pure cellulose obtained from the seed threads of Gossypium (cotton) is tough, fibrous, and completely insoluble in wa
    8·1 answer
  • 2.Exocrine glands such as sweat glands secrete fluids through ducts.
    11·2 answers
  • Anyone know the answer plz help
    7·1 answer
  • What are the effects of a change in protein? there is 3
    9·1 answer
  • What are the living and non-living parts of blood called?
    7·1 answer
  • which could take place by active transport A. the movement of carbon dioxide into a photosynthesising leaf B. the movement of ca
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!