Answer:
Operons afford the organism the opportunity to simultaneously regulate transcription of multiple genes, whose products are active in the same process.
Explanation:
Operon is the group of related genes and the operator and promoter sequences that regulate their expression. All the genes in an operon are expressed together and are under the regulation of the same promoter and operator sequences.
Operons consist of the genes that are involved in related metabolic pathways. For example, the genes that code for the enzymes of lactose catabolism are expressed together as lac operon. It allows simultaneous expression of the genes of lactose catabolism only when lactose is present in the medium. Similarly, these genes are inhibited simultaneously in absence of lactose by binding of repressor protein to the operator sequence.
The right answer is the promoter.
• The promoter is a nucleotide sequence that allows the transcription of the gene into mRNA. It is recognized by the RNA polymerase that initiates transcription. During the synthesis of the RNA, the promoter indicates which gene must be expressed and therefore which proteins the cell must produce. In an operon it is common to all genes.
• The operator is a segment of DNA and / or messenger RNA to which a chemical signal (a regulatory molecule) binds. It can be either a repressor signal or a transcription activating signal (DNA operator) or translation (RNA operator) of the genes of the operon. The RNA polymerase does not recognize this structure.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer: A disease that is not contagious is called a noninfectious disease. These diseases are not caused by pathogens. Instead, they are likely to have causes such as lifestyle factors, environmental toxins, or gene mutations. Common types of noninfectious diseases include cancer, diabetes, and immune system diseases.
Explanation: hope this helps :)
Answer:
<em>The answers are: phrenic nerve, cervical spinal nerve, branches of the cervical plexus, the thoracic, and the root of the lung to reach the diaphragm.</em>
Explanation:
One important branch of the cervical plexus is<u> </u><u><em>the phrenic nerve</em></u>, which is formed primarily from the <u><em> cervical spinal nerve</em></u> and some contributing axons from<u><em> branches of the cervical plexus.</em></u>
This nerve travels trhought <u><em>the thoracic</em></u> cavity to innervate <u><em>the root of the lung to reach the diaphragm</em></u> and its important for breathing.
This question is about the network of nerve fibres that supplies innervation to some of the structures in the neck and trunk.
