Answer:
The resulting cells will not receive the correct number of chromosomes in the gametes, a condition known as aneuploidy.
Explanation:
Formation of functional microtubule spindle fibers and their attachment to kinetochores of chromosomes is required to ensure their alignment st the cell's equator during metaphase. During anaphase, shortening of these microtubules pulls the chromosomes to the opposite poles. These events ensure the distribution of the correct number of chromosomes among the daughter cells. The presence of defective microtubules would not allow proper distribution of chromosomes to the daughter cells and would result in the presence of an abnormal number of chromosomes (aneuploidy).
Answer:
I think it is c since "A scientific theory is an explanation of an aspect of the natural world that can be repeatedly tested and verified in accordance with the scientific method, using accepted protocols of observation, measurement, and evaluation of results. Where possible, theories are tested under controlled conditions in an experiment. "
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Mafic materials are usually dark in color and have relatively high specific gravities grater than 3.0 Felsic materials are usual at lighter in color and have specific gravities less than 3.0
