1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
7

15 POINTS IF U AnYSWER THIS QUESTIONNNNN

Biology
2 answers:
Ilia_Sergeevich [38]3 years ago
3 0

Answer:

Heredity is the inheritance of genes from parent "mice" to their offspring. ... mice have 20 SETS of chromosomes, making 40 chromosomes overall. Each chromosome may not have the same form of allele as the next, since one pair came from the mother and onother the father

Explanation:

bija089 [108]3 years ago
3 0
Heredity is the passing on of physical or mental characteristics genetically from one generation to another. it works in mice by giving the mouse their hair color or eye color, shape and size, and other physical characteristics.

hope it helped
You might be interested in
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Earthquakes cause ___. <br><br> A) seismic waves<br> B) electromagnetic waves<br> C) stadium waves
makkiz [27]

A) earthquakes cause seismic waves.

6 0
3 years ago
Someone help me pleaseeee
Zielflug [23.3K]

Answer:

oxygen and carbon dioxide

5 0
3 years ago
Read 2 more answers
The prosthetic group of hemoglobin and myoglobin is . The organic ring component of heme is . Under normal conditions, the centr
SVEN [57.7K]

The question is incorrect. The correct question is as follows:

The prosthetic group of hemoglobin and myoglobin is _______?

The organic ring component of heme is _______?

Under normal conditions, the central atom of heme is ________?

In ________ the central iron atom is displaced 0.4 A out of the plane of the porphyrin ring system.

The central iron atom has _______ bonds: ________ to nitrogen atoms in the porphyrin, one to a _______ residue and one to oxygen.

Answer:

The hemoglobin is an important protein that transport oxygen in the body and contains the pigment that gives the red color to the red blood cells. The myoglobin protein is responsible for transport of oxygen in muscles.

The heme molecule acts as prosthetic group for both myoglobin and hemoglobin. The porphyrin ring is present in heme molecule. The iron molecule especially Fe2+ is present in heme molecule. The deoxyhemoglbin states occur when the central atom is displaced 0.4 Å. The iron central atom can form six bonds and forms four bonds with the prophyrin of nitrogen and one bond with histidine molecule. Histidine acts as a buffer fir the blood.

4 0
4 years ago
What percentage of het land on the earth is usable for living on but not for agriculture farming?
rodikova [14]

4.3 Agricultural land. At present some 11 percent (1.5 billion ha) of the globe's land surface (13.4 billion ha) is used in crop production (arable land and land under permanent crops). This area represents slightly over a third (36 percent) of the land estimated to be to some degree suitable for crop production.


4 0
3 years ago
Other questions:
  • While _________ involves a splitting off of parts of the personality,_________ involves the existence of multiple, intact person
    12·1 answer
  • What is the smallest living bacteria
    7·2 answers
  • Does Clorox kill cockroach
    10·2 answers
  • Which of the following is NOT true about the absorption of fats?
    7·1 answer
  • A decrease in cell-cell adhesion was caused by the introduction of an experimental substance that compromised the structural int
    8·1 answer
  • Jessica: Pitch is how high or low a sound is. The pitch depends on vibrations. High pitch sounds have low amounts of vibrations
    12·1 answer
  • Is grass poking through a sidewalk crack primary or secondary succession? Why?
    5·1 answer
  • hey could someone help me with this immediately!! i will mark u brainiest if u don’t guess or leave a link!!!
    9·2 answers
  • Help me please, I need this ASAP
    6·1 answer
  • Lymphedema is a disorder in which the lymphatic vessels associated with capillary beds are blocked. What will be the long-term e
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!