1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sati [7]
3 years ago
6

Will give 100 points!! ASAP

Biology
1 answer:
Jobisdone [24]3 years ago
4 0
Uh the answer is B. Humans
You might be interested in
Which color and wavelength of light does chlorophyll b absorb best?
NemiM [27]

Answer:

D

Explanation:

About 660 nm and orangish-red

3 0
3 years ago
Read 2 more answers
In a soil food web is Bacteria and Fungi, dead and decaying organic matter and plants the producers???
Brrunno [24]

Decomposers play a critical role in the flow of energy through an ecosystem. They break apart dead organisms into simpler inorganic materials, making nutrients available to primary producers.

Explanation:

5 0
3 years ago
A small farming community in Texas covers 17 square kilometers. There are 400 individuals who live within the town limits. What
evablogger [386]
6800 hope this helped
4 0
3 years ago
Why might to elements proces why might to elements possess similar chemical properties?
solniwko [45]

Elements in the same group in the periodic table have similar chemical properties. This is because their atoms have the same number of electrons in the highest occupied energy level. Group 1 elements are reactive metals called the alkali metals.

4 0
3 years ago
Describing the Different Levels of Organization
Ivahew [28]

Answer:

the answer is a

Explanation:

because that's the right answer

3 0
1 year ago
Other questions:
  • What is the only cell organelle that is capable of converting light energy into chemical energy
    10·2 answers
  • Which of the following aren't eukaryotes?
    14·2 answers
  • Where do prions come from?
    7·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Hi! ~ヾ(^∇^)
    15·2 answers
  • What might happen to a cell after a virus leaves it?
    7·2 answers
  • |3x - 2) =12<br> I need the answer
    7·1 answer
  • What shape is the sky?​
    10·2 answers
  • Which statement best explains why the atmosphere is considered an open system?
    14·1 answer
  • ANSWER ALL ASAP
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!