1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sati [7]
3 years ago
6

Will give 100 points!! ASAP

Biology
1 answer:
Jobisdone [24]3 years ago
4 0
Uh the answer is B. Humans
You might be interested in
In humans, having freckles (F) is dominant to not having freckles (f). Match he genotype with the appropriate phenotype.
elena-s [515]

Answer:

FF (homozygous dominant)- having freckles

Ff (heterozygous dominant)- having freckles

ff (homozygous recessive)- no freckles.

Explanation:

3 0
3 years ago
In order for any endergonic reaction to proceed, energy must be provided by a coupled exergonic reaction. There is virtually alw
blsea [12.9K]

Answer:

The correct answer is : Released as the heat.

Explanation:

Exergonic reactions that are occurs on it own as there is no need of the energy to initiate these reactions whereas endergonic reactions requires some amount of the energy to initiate it and the required energy come from the exergonic reactions provide a large amount of energy in by breaking the bonds.

Endergonic reactions require less amount than that is released from that released from the exergonic reaction. The energy that is left is lost as the heat after consumed energy by endergonic reaction.

Thus, the correct answer is : Released as the heat.

4 0
4 years ago
(BRAINLIEST +20 POINTS PLS PLS HELP)The processes of photosynthesis and cellular respiration form a continuous cycle, as shown i
anygoal [31]

The process of photosynthesis occurs in the chloroplasts of the cell. It the process in which, carbohydrates are synthesized in the presence of sunlight, carbon dioxide and water, releasing oxygen.

Respiration is a process in which the oxidation of organic compounds like the carbohydrates takes place in the presence of oxygen, producing carbon dioxide, water and energy in the form of ATP. Mitochondria is the site of respiration. The process of photosynthesis and respiration form a continuous cycle as the product of one process serves as a precursor for the other process.

In the image given, the box 2 represents oxygen which is a requirement for the process of respiration. Similarly the box 4 represents carbon dioxide which is a requirement for the process of photosynthesis. Mitochondria is called the power house of a cell as it is the source of energy for all the life processes of the cell. The box 3 represents the energy currency of the cell called the adenosine triphosphate or the ATP.


8 0
3 years ago
Read 2 more answers
Sediments can collect in all of the following EXCEPT: Question 5 options: Mountain tops River deltas Flood plains Shallow seas
melisa1 [442]

Answer:

river deltas flood plains

Explanation:

6 0
4 years ago
What process is used (Mitosis or Meiosis) in the development of a zygote to a multicellular
OleMash [197]

Answer:

Mitosis I think?

Explanation:

5 0
3 years ago
Other questions:
  • Select the items that describe economic growth. Unemployment is very high. Businesses make more products. Consumers spend more m
    13·2 answers
  • The idea that the brain is extremely malleable and is continuously chainging as a result of injury, experiences, or substances i
    7·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • The primary food for Adelie penguins is
    10·1 answer
  • Which type of joint do you think allows for the greatest number of different movements? Explain your reasoning.
    6·1 answer
  • Some amphibians and crayfish can withstand periods of dryness by burying themselves in mud. In
    5·2 answers
  • How do rock fragments carried by rovers affect erosion?
    5·1 answer
  • Which choice is an example of a symbiotic association of a protozoan with its mode of association? . A Plasmodium in the blood c
    10·2 answers
  • How is agrovoltaics different from floatovoltaics? How are they similar?
    8·1 answer
  • Can someone help me out with this? In pea plants, the allele for green seeds (G) is dominant over the allele for yellow seeds (g
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!