1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
insens350 [35]
3 years ago
15

What type of necrosis results from ischemia of neurons and glial cells?

Biology
2 answers:
Fittoniya [83]3 years ago
6 0
<span>The type of necrosis that typically results from ischemia of neurons and glial cells is liquefactive necrosis. Ischemia is an inadequate supply or blood, which causes neurons and glial cells to die. The dead neurons and glial cells result in the tissues becoming a liquid mass, hence the name liquefactive necrosis.</span>
sesenic [268]3 years ago
5 0
The type of necrosis from the ischemia (loss of blood supply) of neurons and glial cells is liquefactive necrosis. Liquefactive necrosis is characterized by loss of tissue structure grossly and microscopically and only fragments of cells as well as neutrophilic (if acute) or lymphocytic (if chronic) cells. Liquefactive necrosis occurs only in the brain and in suppurative processes such as abscesses. 

Other types of necrosis include coagulation necrosis (tissue structure is preserved), gangrenous necrosis (transmural necrosis), enzymatic fat necrosis (in breast tissue and pancreas), and fibrinolytic necrosis (in blood vessels).
You might be interested in
Which of the following are environmental factors
nexus9112 [7]

In simple words, osteoporosis can be stated as the medical state in which the bones become breakable and weak from loss of tissue. Due to the deficiency of calcium or vitamin D.

<u>Explanation:</u>

<u>Environmental factors  that influence osteoporosis:</u>

  • Due to smoking, and consuming alcohol leads to the  Osteoporosis.
  • Intake of Poor diet food and intake of low calcium can leads to Osteoporosis .
  • Chronic diseases like arthritis and liver infection can cause Osteoporosis .
  • Due to the Malabsorption, it will lead to Osteoporosis .
  • Vitamin D helps the body to absorb calcium.
  • When vitamin D is wanting, the body cannot absorb sufficient amounts of calcium to inhibit osteoporosis. Some medications can cause osteoporosis.

6 0
3 years ago
Read 2 more answers
Integrated Natural Resource Management Plans (INRMPs) are mutually agreed upon documents to protect the natural resources on mil
Mars2501 [29]
It’s a it’s the sikes act
3 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which of the following best describes the purpose of examining mammary secretions in mares before parturition?
Arisa [49]

The statement that best describes he purpose of examining mammary secretions in mares before parturition is testing for elevated levels of calcium.

<h3>What is the processes of parturition in mares?</h3>

In parturition, a fetus is fully developed, a process called Ferguson reflex occurs to stimulate contractions. The canal is lubricated by a fluid called allanotic fluid and facilitates the discharge of the amnion and the fetus. A virginal distension releases oxytocin and more contractions.

For a mare to be ready for parturition, elevated levels of calcium is tested from the mammary gland to confirm that the mare is healthy and ready for parturition.

Learn more on parturition here: brainly.com/question/14982881

#SPJ1

3 0
1 year ago
.
horsena [70]

Answer:

C is correct ans

Explanation:

Mark my answer as brainliest and thank me

5 0
3 years ago
Other questions:
  • The "permanent" wave that your local beauty parlor offers depends critically on rearrangements in the extensive disulfide bonds
    5·1 answer
  • This feathered dinosaur is not considered an index fossil because it
    11·1 answer
  • Explain what happens to an embryo during the first two months of pregnancy
    10·1 answer
  • Even though fossils of life that existed 3-3.5 billion years
    9·1 answer
  • Direct gene activation involves a second-messenger system. True or False
    9·2 answers
  • Tall plants are dominant to short plants. What is the outcome if two short plants are crossed.
    8·2 answers
  • All living things are made up of one or more ______.
    8·2 answers
  • A tool used in classification is
    6·1 answer
  • What are two different ways the moon moves?​
    9·2 answers
  • Fax about blue eyes i don't mind two BRAINLES​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!