1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Diano4ka-milaya [45]
3 years ago
10

gọi (c) là đồ thị hàm số y = x ^ 4 + x tiếp tuyến. tiếp tuyến (C) vuông góc với đường thẳng d: x+ 5y =0 có phương trình là

Mathematics
1 answer:
GenaCL600 [577]3 years ago
6 0

Answer:

l,l,l,

Step-by-step explanation:

n   nn

You might be interested in
A direct variation function includes the ordered pair (4, 5). Which statement is true? The constant of variation k is mc001-1.jp
devlian [24]
A direct variation suggest that the value of x in the equation would greatly affect the value of y such that when x is increasing, y also increases and the other way around. The equation for a direct variation is that,
                               y  = kx
Substituting the given values in the ordered pair,
                           5 = k(4)   ; k = 5/4
7 0
3 years ago
Read 2 more answers
Consider the given geometric sequence.
Gala2k [10]
F5=(256)f1=16 hope this helps
7 0
3 years ago
Read 2 more answers
Given that (6 3) is on the graph of f(x) find the corresponding point for the function f(-1/2x)
Vlada [557]
\bf \begin{array}{rllll}
(6&,&3)&f(x)\\
x&&y\\\\
(-\frac{1}{2}x&,&3)&f(-\frac{1}{2}x)\\\\
(-\frac{1}{2}\cdot 6&,&3)\\\\
(-3&,&3)
\end{array}

keep in mind that, a negative coefficient to "x", will make the graph reflect over the y-axis.
6 0
3 years ago
Read 2 more answers
Pls help ;-;
anyanavicka [17]

Answer:

C

Step-by-step explanation:

A closed circle means inclusive, and -2 is included in values that would make the equation true. Then you just have to test another number greater than and less than -2 to see which way the arrow should point.

-3(-3) + 1 < 7

9 + 1 < 7

10 < 7 FALSE

-3(0) + 1 < 7

1 < 7 TRUE

All values (including -2) will make this equation true

6 0
3 years ago
Read 2 more answers
Can you help me with this question?
kirill [66]

Yes

Hope this helps                          

5 0
3 years ago
Other questions:
  • ~PLEASE HELP ASAP OFFERING 30 POINTS~
    13·2 answers
  • H varies directly as L. If H=20 when L=50, determine H when L=30
    9·1 answer
  • 3 parts of a yellow paint are mixed with 4 parts of red paint to make orange paint. Zahid has 75ml of yellow paint and 120lml of
    8·1 answer
  • What is the solution to the equation x^3=64?<br> X=
    8·1 answer
  • Jan went grocery shopping and only bought items which had been marked down. The items she bought, along with their prices, can b
    5·2 answers
  • For the geometric sequence: 112.5, 225, 450, 900,..., find the 21st term.
    15·1 answer
  • What is the result of isolating y2 in the equation below?<br><br> (x - 2)^2 + y2 = 64
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 36/12^2+8 plSSSS halp
    15·2 answers
  • You put 100$ in a savings account for six months at a rate of 0.2%
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!