1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetllana [295]
4 years ago
7

A portion of grass in a prairie ecosystem was destroyed by wildfire. What will most likely happen to the population of bison tha

t feed on the grass?. a.. The number of bison will increase.. b.. The number of bison will decrease.. c.. The bison in the ecosystem will be completely wiped out.. d.. The number of bison will remain unchanged.
Biology
2 answers:
amm18124 years ago
4 0

The correct answer is B. on e2020.

seropon [69]4 years ago
4 0

Answer: b. The number of bison will decrease

Explanation: A prairie ecosystem is mainly dominated by grasses and shrubs as vegetation which are the source of food for large number of herbivores in the ecosystem. The grasses if burn by the wildfire will decrease the population of bison which was dependent upon them as a source of food.

You might be interested in
Which of the following terms describes the following:
Tamiku [17]

Answer:

specific heat

Explanation:

Can I be brainliest? TYSMMMMMMMMM

4 0
3 years ago
What is the voltage across a membrane called?
Marina86 [1]
It is called a cell membrane potential
3 0
3 years ago
Which cellular structure makes it possible for a cell to differ structurally and biochemically from its surroundings? select one
icang [17]
Do you have any options?
8 0
4 years ago
Which answer is not a mechanism for evolution? Genetic Drift Mutations Gene pool Natural Selection
lawyer [7]
Genetic drift I think
3 0
3 years ago
Read 2 more answers
Is a carbohydrate organic, inorganic, or ionic?
viva [34]

Answer:

the answer to this is organic

5 0
3 years ago
Other questions:
  • The antepartum nurse is caring for a patient with a family history of neural tube defects. the patient declines genetic counseli
    14·1 answer
  • In this exercise, you will identify when various events occur during the cell cycle. recall that interphase consists of the g1,
    13·1 answer
  • At various times, Cynthia, a 20 year-old college student, has been considered by her family and/or friends to be moody, high-str
    6·1 answer
  • In some national parks, controlled fires are maintained by firefighters. Which of these is one of the major reasons for using co
    8·2 answers
  • PLEASE HELP ME QUICK!!!
    14·1 answer
  • In the cell cycle of typical cancer cells, mutations have most likely caused -
    13·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What does the system of classifying things based first into broad categories, then into progressively more specific categories,
    12·1 answer
  • The strongest and biggest organism is always more fit for the environment.<br> True<br> False
    5·1 answer
  • Compare and contrast the nutritional mode of a fungus with your own nutritional mode.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!