Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Parietal and frontal.. whichever one your looking for
This is a easy one! a promoter<span> is a region of DNA that initiates transcription of a particular gene. </span>Promoters<span> are located near the transcription start sites of genes, on the same strand and upstream on the DNA</span>
The genotype<span> of an organism is defined as the sum of all its genes. The </span>phenotype<span>of an organism is the observable physical or biochemical characteristics of an organism, determined by both genetic make-up and environmental influences
</span><span>Mark as brainlist if correct please and have a blessed day!
</span>
