1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
CaHeK987 [17]
2 years ago
7

Which traits make fungi more related to animals than to plants? (4 points)

Biology
1 answer:
Marta_Voda [28]2 years ago
7 0

Answer:

A. heterotrophic,chitin in cell walls

Explanation:

You might be interested in
A 38-year-old accountant comes to your clinic for evaluation of a headache. the throbbing sensation is located in the right temp
spayn [35]
The diagnosis we can make according, to this information, is a migraine with aura.
- A migraine is a chronic headache, most likely genetic. It is often a disturbing disease because of the frequency, duration and intensity of crises, with repercussions on daily life, work or school.
A migraine with aura (a classic migraine, Unlike a commune migraine without aura): There's a recurrent headaches, typically preceded by neurological manifestations (like a light sensitivity), reflecting a localized, transient brain dysfunction.

The cause can be the abuse of drugs, according to the fact that she takes over-the-counter drugs. It can also be anxiety or depression or even due to genetic factors.
4 0
3 years ago
Which molecule enters the Calvin Cycle? Which molecule leaves?
KonstantinChe [14]
ATP enters the Calvin Cycle. Glucose (G3P) is a molecule that leaves the cycle. 
7 0
3 years ago
Where could you find mesophiles ?
lesya [120]
D. all of the above hope it helos
4 0
3 years ago
Read 2 more answers
Desmosomes form channels that allow each cardiocyte to electrically stimulate its neighbors. True False
dimulka [17.4K]

Answer:

False

Explanation:

The most specific feature of cardiac muscles is the presence of intercalated discs. Intercalated disc connects the ends of cardiac muscle fibers to one another. The discs have desmosomes and gap junctions. The function of desmosomes is to hold the cardiac fibers together. The gap junctions of cardiac fibers allow muscle action potentials to spread from one cardiac muscle fiber to another. These gap junctions have tubular connexons that form channels and connect the cytosol of adjacent cardiocytes to allow the flow of ions and spread of action potential from one cell to another.  

5 0
3 years ago
The function of the medulla oblongata is?
Scilla [17]

Answer:

d. It also includes , breathing, digestion, swallowing

5 0
2 years ago
Other questions:
  • The dots represent a bacterial infection. Sal was very sick with this bacterial infection. The infection was treated with antibi
    13·2 answers
  • The human genome project identified the sequence of base pairs in human DNA and identified several genes. Which question would l
    8·2 answers
  • One of the most popular taxonomic tools is dna fingerprinting to develop profiles of organisms. these profiles provide direct in
    9·1 answer
  • Scientists on a space shuttle mission studying plant growth would probably see that the plants on the space shuttle do not grow
    5·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • About how much energy is transferred from a primary consumer
    5·1 answer
  • Near a mid-oceanic ridge you can find...
    14·1 answer
  • Plz help i will give u BRAINLIEST
    10·1 answer
  • Fleas living on a dog are examples of what symbiotic relationship? .A .mutualism .B competition .C parasitism .D predator-prey
    11·1 answer
  • Interpret the following scenario to distinguish between recessive and dominant forms of inheritance. Two unaffected parents that
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!