Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
Given the data gathered, we can confirm that the problem with the greenhouse lies in an error that is affecting the rate of photosynthesis.
<h3 /><h3>How do we know that photosynthesis is affected?</h3>
- This can be deduced by the levels of carbon dioxide and Oxygen.
- Photosynthesis is a process that <em><u>consumes </u></em>carbon dioxide.
- This would mean we expect the levels of CO2 to decrease, which is not the case.
- Additionally, photosynthesis produces oxygen as a byproduct, meaning the levels of Oxygen should increase, though the <u>opposite </u>is happening here.
Therefore, because photosynthesis is a chemical reaction used by plants to take in carbon dioxide and produce oxygen as a result, we can confirm by the increasing levels of carbon dioxide, that photosynthesis in the greenhouse is occurring at reduced rates.
To learn more about photosynthesis visit:
brainly.com/question/1388366?referrer=searchResults
Answer:
The primary visual cortex is located in the Occipital lobe .
Explanation:
The primary visual cortex also called V1 , is a part of cerebral cortex which process our visual information , the location of primary visual cortex is present in occipital lobe.
The visual nerves are present straight from eye to the primary visual cortex to the visual association cortex.
The primary visual cortex , is necessary for the conscious processing of the visual stimuli.
The host cell bursts to release the newly formed virus particles and then it dies.
None...........................probably mars
