1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aivan3 [116]
3 years ago
10

If a disease is sex-linked, what pair of chromosomes must contain the gene responsible for the disease?

Biology
1 answer:
Setler79 [48]3 years ago
4 0

Answer:

23rd Pair

Explanation:

Took bio last year, I know it's right, hope it helped

You might be interested in
Which part of the ear is infected during ear infections?
Veseljchak [2.6K]

Answer:

It's the middle ear.

Explanation:

The official diagnosis is "otitis media" which translates as otitis = inflammation of the ear, and media = middle

4 0
3 years ago
the skull forms a solid sheet of protection and the ribs form a cage. why do you think the rib cage is not a solid sheet like th
Sergeeva-Olga [200]

I think the the ribs are not a solid sheet because they need to be able to expand so the lungs can get an adequate amount of air in the lungs. The brain just needs to be protected and doesn’t need to expand so it’s a solid sheet. The skull seems to be the better protector at first because the ribs can break and puncture a lung, harming your breathing but if you do hit your head your brain can start swelling and the skull doesn’t allow any room for expansion. Head injuries are much more dangerous, especially if the brain starts swelling. Rib injuries seem much simpler to fix and less dangerous.

5 0
3 years ago
During which three phases are individual chromosomes no longer visible
avanturin [10]
I believe it is interphase
5 0
3 years ago
Read 2 more answers
Explain why humand cannot impact one of earths systems without impacting the others​
Natalija [7]

humans cannot impact one of Earth's systems without impacting the others because Earth's systems are interconnected. They interact with each other, moving matter from one system to the other. Changes to the atmosphere brought about by human activity eventually lead to changes in the biosphere and hydrosphere.

7 0
3 years ago
Besides the number of varieties of potatoes being reduced, what else is reduced by this practice
aev [14]
<span>The potato gene pool is being reduced.</span>
5 0
4 years ago
Other questions:
  • How does dna carry information for specifying the traits of an organism?
    10·1 answer
  • Which of the following explains the difference between a carrier of a sex-linked disorder and a carrier of an autosomal disorder
    12·1 answer
  • From a large-scale screen of many plants of collinsia grandiflora, a plant with three cotyledons was discov- ered (normally, the
    8·1 answer
  • When constructing a Punnett square, the symbols on the outside of the boxes represent _______, while those inside the boxes repr
    14·1 answer
  • Overexertion in extremely hot temperatures helps the body to cool itself. true false
    11·2 answers
  • In which type of interaction do both species benefit?
    6·2 answers
  • Please help me with 1-5
    5·1 answer
  • Ice acts as an ______ that allowed the water underneath to remain as a liquid.
    6·1 answer
  • Certain species of whiptail lizards have only female individuals and no males. These lizards reproduce asexually. What is one di
    14·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!