D. Decomposers return everything back to the environment
When focusing on a slide, ALWAYS start with either the 4X or 10X objective. Once you have the object in focus, then switch to the next higher power objective.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
A great example is the peppered moths evolution. Since the Industrial Revolution the birch trees started to turn black from the soot. This casued all the white moths to be eaten from birds. The ones that were left to mate were black moths which favored the black gene. So overtime black moths became more common. They were naturaly selected based on color to survived and pass down their black colored genes.
Explanation:
Answer:
A) releasing carbon dioxide into the air
