1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mandarinka [93]
3 years ago
13

A energy rich organic compound needed by organisms is what

Biology
1 answer:
adelina 88 [10]3 years ago
6 0

Answer:

Food (Glucose)

Explanation:

Glucose provides us with energy that is obtained through a process known as glycolysis of carbohydrates. They are our most primary sources of energy. However, Glucose only enters organs and cells, through insulin produced by the pancreas.

You might be interested in
Why is hand washing so important and when should hands be washed?
natta225 [31]
Hand washing is of importance for its hygenic and cleanliness is important and reduces bacteria and potential viruses and its best if The average human washes their hands if they engage in activities that are messy or not hygenic and its common and necessary that washing ur hands is something we humans do a lot of. Hope this helped.
7 0
4 years ago
Give two names for a hydrogen atom with a missing electron
Marina86 [1]

Answer:

Cation,anion

Explanation:

6 0
4 years ago
An arthropod's exoskeleton performs all of the following functions except
Mars2501 [29]
A. production of gametes
3 0
3 years ago
Read 2 more answers
An environmental scientist might study the effect of soil pollution on plant growth.
Elena L [17]
  • <u><em>True.</em></u>

As...Environmental scientist studies the interaction of the living components of the ecosystem with the non living components.

The contamination in the soil will affect the growth of plants, this will also be studied by the environmental scientist.

The Growth of the plant depend on the quality of soil in which it is grown so it will also be a concern for the environmental scientist.

6 0
3 years ago
ANSWER QUICKLY
Molodets [167]

Answer:

B

Explanation:Im on brainpop too and it says the answer is b

5 0
3 years ago
Other questions:
  • BRAINLIESTTTT ASAP!!!
    9·1 answer
  • Teddy is afraid of needles and injections. whenever the nurse attempts to give him an injection, he screams and flails his arms
    5·2 answers
  • What are the processes in which materials move through a cell membrane?
    8·1 answer
  • How will you explain the sudden boost of energy, increased strength to lift very heavy objects during emergency situations
    15·2 answers
  • Which of the following is a contributing reason behind emerging disease?
    5·2 answers
  • Which statement is least likely to support the endosymbiotic theory?
    10·2 answers
  • Landforms is a physical feature on earth's surface true or false
    11·2 answers
  • Which type of energy used on earth comes directly from the sun
    9·1 answer
  • Natural selection is driven by which of these? *
    11·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!