1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eimsori [14]
2 years ago
13

How are crime and deviance similar?

Law
2 answers:
Stels [109]2 years ago
5 0

Answer:

Deviance is behavior that violates social norms and arouses negative social reactions. Crime is behavior that is considered so serious that it violates formal laws prohibiting such behavior. Social control refers to ways in which a society tries to prevent and sanction behavior that violates norms.

Explanation:

hope that helps

larisa86 [58]2 years ago
4 0

Answer:

Deviance is behavior that violates social norms and arouses negative social reactions. Crime is behavior that is considered so serious that it violates formal laws prohibiting such behavior. Social control refers to ways in which a society tries to prevent and sanction behavior that violates norms.

Explanation:

You might be interested in
Trial courts in the federal judicial system are called.
kogti [31]

Answer:

The constitution created the Supreme Court and authorized Congress to pass laws establishing a system of lower courts. In the federal court system's present form, 94 district-level trial courts and 13 courts of appeals sit below the Supreme Court.

Explanation:

3 0
1 year ago
What percentage of women experience sexual assault while attending college or university?
Ksivusya [100]

Answer:

I think this is the answer

8 0
2 years ago
Which statement is part of the 3R rule?
bonufazy [111]
The 3R rule states that Radial cracks form a Right angle on the Reverse side of the force. This rule enables an examiner to determine readily the side on which a window or pane of glass was broken.
5 0
2 years ago
Read 2 more answers
The __________ terms of a contract are those terms that would allow a court to determine what the damages would be in the event
Lynna [10]

Answer: Material

Explanation:

The material term are basically used to determined the significant problem in the breaches the contract like the damages in the quality and performance. In this, it is right the contractual part to sue for the contract breaches. The material terms are also referred in terms of the issue in price and quantity of the contract party.

7 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
Other questions:
  • Assume that Big Drug Company (BDC) was one of ten drug manufacturers that produced and sold a drug in Ohio that was found to cau
    5·1 answer
  • The Equal Employment Opportunity Commission (EEOC) possesses the authority to ________. investigate and reconcile whether a clai
    8·1 answer
  • List any 5 powers of the President and identify the Section(s) in which they are found.
    11·2 answers
  • What are the characteristics of the “Gold Standard” of behavioral science, the experimental model
    12·1 answer
  • The fifth amendment protects citizens against self-incrimination
    11·2 answers
  • Please help! Will mark brainliest
    9·1 answer
  • Thanks you
    13·1 answer
  • vì sao lại phải quy định những nơi sử dụng lao động không được đình công tại điều 209 bộ luật lao động năm 2019
    6·1 answer
  • A traveler needs to claim reimbursement for their transportation costs and payment of their per diem allowances. Which travel do
    14·2 answers
  • How does Vicksburg Firearms try and back up their case in the courtroom (who testifies, what do they say, what evidence is intro
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!