1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dsp73
3 years ago
9

Please help now!! What is the difference between at atom and an element?

Biology
2 answers:
Novay_Z [31]3 years ago
3 0

Answer:

An atom is the smallest particle of matter and is made of protons, neutrons, and electrons. An element is a substance made of only one type of atom, and three examples of elements are carbon, oxygen, and gold.

Explanation:

Molecules are made of two or more atoms combined together.  Find a way to rewrite this so you do not get caught for plagirism.

deff fn [24]3 years ago
3 0
Yeahhhhhh she’s righttttttt
You might be interested in
Ayudaaaaaaaa por favorrr​
kvv77 [185]
Que quieres que aga
4 0
3 years ago
Read 2 more answers
During Anaerobic respiration:
Brums [2.3K]
The answer is A as during anaerobic respiration, as there is no oxygen, glucose is converted into ethanol and lactic acid to produce some energy.
4 0
3 years ago
How many chromosomes do sperm cells and egg cells have?​
aalyn [17]

Answer:

23 chromosomes

Explanation:

A human body all together has 46 chromosomes but sperm and egg cells are gametes, or sex cells meaning each half of a parent created 46 all togehter. They are haploid cells while everything else are diploid.

8 0
3 years ago
Read 2 more answers
Please faster i need the answer now
Sholpan [36]

Answer:

REACTANTS CARBON DIOXIDE+ OXYGEN

PRODUCTS:Glucose+Lactic Acid+Energy

3 0
2 years ago
What is a binomial nomenclature?
patriot [66]
A because is a system of naming organisim.the first is the genus followed by specific epithet

3 0
3 years ago
Read 2 more answers
Other questions:
  • Coleoptera larvae, insects that eat corn plant roots, are shown in the petri dishes below. Select the statement that is correct
    12·1 answer
  • One reason why it is against the law to feed wild dolphins is because select one:
    8·1 answer
  • Which of the following can be used to explain why water is able to dissolve many substances
    10·1 answer
  • Mr. Mann's class conducted an experiment about plant response to the presence of water. They first planted pea seeds in sand. In
    5·2 answers
  • PLEASE HELP WIILL GIVE BRANLIEST !!!!!!
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • which types of freely movable joints are often found in areas of the body such as the shoulders and hips needing movement in man
    10·1 answer
  • Que significa presión osmotica?
    8·1 answer
  • ​​​​​​​​​If natural gas gives off 30 units of energy, but takes 5 units of energy to produce, what is its net energy ratio?
    12·2 answers
  • Scientists once believed that modern-day reptiles were the only living descendants of dinosaurs, which were reptiles. Accumulati
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!