1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olganol [36]
3 years ago
13

When does oxygen uptake in the alveoli increase? Select all that apply. Carbon dioxide in the body decreases. Oxygen in the body

decreases. Oxygen in the body increases. Carbon dioxide in the body increases.
Biology
1 answer:
Mice21 [21]3 years ago
6 0

Answer:

oxygen decreases and co2 increases

Explanation: to try to do more gas exchange

You might be interested in
Is interphase G1 part of cell division Y or N
irga5000 [103]

Answer:

Most cells of adult mammals spend about 24 hours in interphase; this accounts for about 90%-96% of the total time involved in cell division. Interphase includes G1, S, and G2 phases. Mitosis and cytokinesis, however, are separate from interphase

4 0
3 years ago
What is the importance of sustainable agriculture?
natali 33 [55]
You  know it girl!!

I am not sure but maybe  very much because without agrciulture we are doomed to a land without basic neccesities
7 0
4 years ago
URGENT!!
vodomira [7]

Answer:

cytoplasm

Explanation:

In eukaryotic cells, DNA is located inside the nucleus so the processes are separated both in location and time. Replication and transcription occur in the nucleus, while translation occurs in the cytoplasm.

8 0
4 years ago
Read 2 more answers
What function does diffusion have in the cell
Flauer [41]
Cell utilize this process to transport materials across the cell membrane without the expenditure of energy.
5 0
4 years ago
All multicellular organisms begin as a single cell. within four or five days, the first cell multiplies into a ball-like structu
NeX [460]

The right answer is blastocyst.


The blastocystic Stage of embryo development is characterized by the formation in the center of the morula (embryonic cell group) of a cavity isolated from the external environment: the blastocoele.

In embryonic development, this step precedes gastrulation.

Blastocysts are indeed composed of a hundred cells; they have the shape of a hollow sphere at the bottom of which is the mound of the "embryonic bud" from which the embryonic stem cells are derived.

6 0
3 years ago
Read 2 more answers
Other questions:
  • What landform is created when magma squeezes between rock layers to form a hardened slab of rock?
    15·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Which two scientists helped to disproved the idea of spontaneous generation?
    7·1 answer
  • Name the part of the the brain labeled "E".
    15·1 answer
  • Why rice genome has higher gene density than wheat genome?
    6·1 answer
  • Bacteria and bacteriophages are undergoing an evolutionary battle. In particular, phages that infect Salmonella enterica can use
    11·1 answer
  • Give the two ways nitrogen can be fixated so plants can use it to grow.
    9·1 answer
  • How are the villi similar to root hair cells?
    9·1 answer
  • Which is not a function of the respiratory system? A. It warms air entering the body. B. It exchanges oxygen and carbon dioxide.
    9·2 answers
  • . What is a producer? Give two examples.<br>i am giving 30 points​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!