1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kobotan [32]
3 years ago
6

The organelle is what part of the cell

Biology
1 answer:
frozen [14]3 years ago
5 0

Answer:

cell wall

Explanation:

if its not one of the options sorry!

You might be interested in
Lightly place your fingers on your wrist or neck and try to find your pulse. Count your pulse for 10 seconds and then multiply t
lubasha [3.4K]

Answer:

Stress can send hormones like adrenaline and cortisol racing through your blood, which can raise your heart rate. Things like meditation and yoga can help lower stress levels. Over the long term, they can lower your resting heart rate, too

Explanation:

Stress can send hormones like adrenaline and cortisol racing through your blood, which can raise your heart rate. Things like meditation and yoga can help lower stress levels. Over the long term, they can lower your resting heart rate, too

3 0
2 years ago
All living things need energy; it is a requirement for life. In a typical cell, ATP, the high energy molecule, is produced in th
tester [92]
All living things need energy; it is a requirement for life. In a typical cell, ATP, the high energy molecule, is produced in the MITOCHONDRIA <span>in the presence of a sugar (glucose) and OXYGEN.

Answers are in the cap. letters!

Hope this helps!</span>
6 0
3 years ago
Read 2 more answers
In a hypothetical population of 1,000 people, tests of blood-type genes show that 160 have the genotype aa, 480 have the genotyp
Salsk061 [2.6K]
<span>This question can be solved using Hardy-Weinberg equation. The equation would be:
a+b=1
</span>a^2+2ab+b^2=1

<span>There are 360 individual with genotype bb which means
b^2=360/1000
b=</span>√0.36= 0.6

The frequency of b allele would be: 0.6
7 0
3 years ago
Earth is made mostly of metals and rocks. where did this material come from?
Viktor [21]
 comes  from the earth's crust<span />
6 0
3 years ago
10. A protein enters a cell. The outside of the cell has a higher concentration of that protein than the inside of the cell. Did
tekilochka [14]
Passive transport process.
7 0
3 years ago
Other questions:
  • Which of the following biomolecules typically contains both nitrogen and phosphorus?
    11·1 answer
  • Which medical terminology word part provides the meaning of a word
    10·2 answers
  • What advantage is the layer of spongy bone found on the inside of a long bone?
    15·1 answer
  • When would a forest be sustainable?
    10·1 answer
  • What are genes
    8·1 answer
  • A scientist isolates the dna from a frog
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Strong contrasts in texture have what effect on a monochromatic design?
    15·1 answer
  • Which of the following would be the term for "a producing or feeding level in a food chain"?
    8·2 answers
  • While dry cleaners are small businesses, they generate relatively large volumes of hazardous substances. EPA estimates the avera
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!