Answer:
I think
Abiotic natural capital comprises subsoil assets (e.g. fossil fuels, minerals, metals) and abiotic flows.
Biotic natural capital or ecosystem capital consists of ecosystems, which deliver a wide range of valuable services.
Hope this Help!:)
Answer:
The immune system protects the host from pathogenic organisms (bacteria, viruses, fungi, parasites). To deal with this array of threats, the immune system has evolved to include a myriad of specialised cell types, communicating molecules and functional responses.
Explanation:
Answer:
more exposure to sunlight and therefore increase photosynthetic production
Explanation:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Oviraptor means "egg theif"
Oviraptors could have 20 eggs at a time
They lived in Mongolia
The aren't necessarily true raptors
Oviraptors were about 6 - 8 feet tall
The first oviraptor was found in 1924 (i believe)
Oviraptors lived in the Cretaceous period.
Oviraptors most likely weighed 60 - 70 pounds.
They were renamed, as "ovinutrix"
The first fossil of oviraptors was found with eggs.
Brainliest please?
