1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
5

When performing an experiment you should only have one manipulated variable because why

Biology
1 answer:
sammy [17]3 years ago
7 0

Answer:

See the answer below

Explanation:

Only one manipulated variable should be present when performing an experiment <u>so as to be able to isolate the effects due to the changing of that variable alone</u>.

<em>When more than one variable is manipulated, it becomes difficult to determine which of the manipulated variables is producing the observed effects on the experimental subjects. Thus, the manipulated variable is the variable on which measured variables during the course of an experiment depends.</em>

You might be interested in
If the average length of a woman's ovarian cycle is 30 days, the average length of her uterine cycles is most likely ____ days.
dybincka [34]

If the average length of a woman's ovarian cycle is 30 days, the average length of her uterine cycles is most likely 28 days.

<h3>What is the ovarian cycle?</h3>

The female ovarian cycle refers to the sequence or cycle that controls the production and release of eggs as well as the the monthly secretion of the hormones estrogen and progesterone.

Hence, if the average length of a woman's ovarian cycle is 30 days, the average length of her uterine cycles is most likely 28 days.

Learn more about ovarian cycle:brainly.com/question/14224887

#SPJ1

6 0
2 years ago
Question 1: Some cells produce and secrete high levels of digestive proteins. Which organelles would you expect to be abundant i
Bumek [7]

Answer:

q1 : ribosomes because they are responsible for protein synthesis

q2 : by transporting potassium ions into the cell and sodium ions out of the cell maintaining a concentration gradient

q3 : seawater contains a high concentration of sodium and chlorine ions that the Atlantic cod gets rid of by actively transporting them out of its body

8 0
3 years ago
After being rushed to the hospital, charlene is told she has an ectopic pregnancy. what does this mean?
Morgarella [4.7K]
This means that the fertilized egg has implanted in the fallopian tube and is growing outside of the uterus. An ectopic pregnancy occurs when the fertilized egg settles and grows in any location other than the inner lining of the uterus. Most of these cases occurs in the Fallopian tube (tubal pregnancy). If untreated ectopic pregnancy can be a medical emergency. 
7 0
3 years ago
The brain's ability to restructure its neural networks to maximize functioning after an injury is known as
igor_vitrenko [27]
This capacity is known as Neuroplasticity. Neuroplasticity is the change in neural pathways and neurotransmitters that happens because of specific variables, similar to conduct, condition, or neural procedures. Amid such changes, the cerebrum participates in synaptic pruning, erasing the neural associations that are never again fundamental or helpful, and reinforcing the vital ones.
7 0
4 years ago
Which is a hypothectical string theory weightless particle
finlep [7]
Gravitron is a hypothetical String Theory Weightless Particle.
4 0
3 years ago
Other questions:
  • Which describes oxygen content as Earth evolved over time? Oxygen levels sharply declined about 400 million years ago. Oxygen le
    8·2 answers
  • Which of the following has a true coelom? in. flatworms b. hookworms c. tapeworms d. earthworms
    10·1 answer
  • What genes direct the
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What is the meaning of nutrition​
    9·2 answers
  • Submit your crime-scene notebook, including responses to the following items:
    7·1 answer
  • Which of the following is not a reason why there has there been so much attention given to saving tropical rainforests?
    11·2 answers
  • An ecosystem experiences a volcanic eruption that covers the area with lava. Which of the following organisms is most likely to
    9·1 answer
  • What causes the doldrums to be calm winds?
    9·1 answer
  • During an allergic response to a bee sting or pollen, which of the following hormone is often released?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!