1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
3 years ago
8

Are the 4 basins of the ocean, pacific, indian, atlantic, and arctic connected or not connected?

Biology
1 answer:
bixtya [17]3 years ago
7 0
They are all connected
You might be interested in
Indicate whether the sentence or statement is true or false.
astra-53 [7]

Answer: No

Explanation: if a nucleic acid contains uracil then it is not DNA it's an RNA. Uracil is the basic nitrogenous base of RNA. DNA does not have Uracil in its structure. It contains thiamine instead of Uracil. So the answer is NO.

3 0
3 years ago
"The time shown in the graph is most likely measured in
Cerrena [4.2K]
The answer that seems like would best fit this graph would be "(4)Years"
4 0
3 years ago
24. A limiting factor for a field planted with corn every year is most likely -
Dafna11 [192]
A

Planting the same crop over and over again depletes the nutrients of the soil and it also allows any pests to get used to the soil. That’s why many people practice crop rotation.
3 0
3 years ago
In a cross between two heterozygous tall and purple flowers (TtPp x TtPp), what would the
Goryan [66]

Answer:

9:3:3:1

Explanation:

This question involves two different genes coding for height and flower color respectively. The first gene posseses allele T (dominant) and t (recessive) while the second gene possesses allele P (dominant) and p (recessive).

According to this question, two heterozygous tall and purple flowers are crossed i.e. (TtPp x TtPp). Each parent will produce the following gametes combination:

TtPp - TP, Tp, tP, tp

Using these gametes in a punnet square, the following proportion of offsprings will be produced:

T_P_ (tall, purple) = 9

T_pp (tall, white) = 3

ttP_ (short, purple) = 3

ttpp (short, white) = 1

Hence, the ratio of this cross is 9:3:3:1

5 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • PLEASE HELP! WILL MARK AS BRAINLIEST!!!
    13·2 answers
  • A pink snapdragon plant is crossed with a red snapdragon plant. What percent of the offspring can be predicted to have white flo
    12·2 answers
  • The spaces between cells in an animal's body is filled with ______ fluid what is the fluid called
    7·1 answer
  • 1. Heat always moves from an object of
    6·2 answers
  • How to create petroleum<br>​
    10·2 answers
  • Which of these statements partially defines law?
    5·1 answer
  • WILL MARK BRAINLIEST!!
    7·1 answer
  • Please help I’ll give brainliest
    11·1 answer
  • Explain the process of cellular respiration and why it is important for the<br> cell.
    14·1 answer
  • Function of the rod cells<br>Responsible for vision at low light levels
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!