1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lesechka [4]
3 years ago
15

The main function of the human digestive system is to A. rid the body of cellular waste materials B. process organic molecules s

o they can enter cells C. break down glucose in order to release energy D. change amino acids into proteins and carbohydrates
Biology
2 answers:
Pavel [41]3 years ago
6 0

Answer:

Hi there your answer is B

Explanation:

There are a lot of functions to the digestive system like absorbing nutrients, get rid of waste but the main function is to process organic molecules so they can enter cells.

Hope this helped :)

-BARSIC- [3]3 years ago
4 0

Answer:B

Explanation:hi

You might be interested in
What is the function of the amino functional group?
stealth61 [152]

I found this info if this is what you need link http://www.answers.com/Q/What_are_the_functional_groups_of_amino_acids

Two functional groups are found in all amino acids. These functional groups are the  

amino group

(-NH2) and the  

carboxyl group

(-COOH). The hydrogen atom of the carboxyl group can be broken off quite easily; this gives amino acids their acidic properties.  

Function of amino acids?

Heat and Energy, Growth, To defend against disease, and to Repair bodily cells are the functions of amino acids/ proteins.  

Amino acids contain a carboxyl group?

Yes, amino acids contain: 1) an amino group (-NH 2 ) 2) a central carbon and variable side group 3) a carboxyl group (-COOH)  

What is the function of amino acids?

Amino acids are nitrogen-containing molecules that serve vitalfunctions in your body. Twenty-two amino acids occur in nature, and20 of these are incorporated into proteins and other moleculeswithin the cells and tissues of plants and animals. According toscientists at the University of Arizona, your body can synthesize10 of the amino acids you need, while the other 10 must be acquiredfrom your diet. Amino acids that cannot be produced within yourcells are called essential amino acids. http://www.livestrong.com/article/426255-what-is-the-function-of-amino-acids-in-the-human-body/  

What is the amino group on an amino acid?

The amino group is present at one end of the amino acid and is represented by the chemical formula NH 3 The region on the amino acid that contains the amino group is called the amino terminal  

Amino acid function?

Amino acids are basically known as the building blocks of protein.The function of an amino acid is primarily to build proteins.

4 0
3 years ago
Why do you think it is important that the sugar – phosphate backbone of dna is held together by covalent bonds, and the cross –
Yanka [14]
As covalent bonds are strong it makes the sugar phosphate backbone a stable molecule which will HV less chances for a mutation while the huydrogen bonds exist for the ease of DNA replication as they are strong in a way but weak for the replication to take place easily.
4 0
2 years ago
1. For any type of rock to become sedimentary rock, what must first happen
svet-max [94.6K]

Answer:

The rock must be eroded into sediment

Explanation:

In order to form sedimentary rock, the accumulated sediment must become compacted and cemented together.

4 0
2 years ago
When a system of classification is based on observation of a predetermined set of factors, it is called: a natural system, an ar
Viefleur [7K]
It is called an artificial system. 
4 0
3 years ago
Read 2 more answers
In _______ reactions, the products have higher energy than the reactants, and in _________ reactions, the reactants have higher
saul85 [17]
In exothermic reactions, the products have higher energy than the reactants, and in endothermic reactions, the reactants have higher energy than the products.
7 0
2 years ago
Other questions:
  • If a person eats salty food, his or her kidneys respond by excreting excess salt into the ____. sodium water urine blood Save
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • which of the following can result in a population looking more similar overtime and can be described as selection against both e
    5·1 answer
  • Complete the following vocabulary exercise related to DNA replication. Match the words below with the appropriate blank in the s
    12·1 answer
  • Que es el potencial de acccion
    5·1 answer
  • When the team captured underwater footage of a juvenile pygmy blue whale, what else did the crewnotice in the water and why were
    12·1 answer
  • Why are some people asymptomatic?
    5·1 answer
  • Describe one of the three types of volcanoes we discussed today
    14·1 answer
  • WILL GIVE BRAINLEST! Think about the hypanthium, which is the fleshy part of the apple that we eat. Many animals find the hypant
    11·1 answer
  • What is a chromosome made of
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!