1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BARSIC [14]
3 years ago
12

A home gets its water from a private well. Which of the following is a sign that the water's quality may be low? (2 points) The

water changes odor The water changes color The water changes taste All of the above
Biology
2 answers:
Fantom [35]3 years ago
6 0
I think it is all of the above
inn [45]3 years ago
4 0

The answer is all of the above.

You might be interested in
A group of paleontologists discovered fossil remains of a new organism. They noted the following features of the organism:
Dmitry_Shevchenko [17]

Answer:

kdnejdhdkdlsfwnksksusvzgsnwkkzlsojd

6 0
3 years ago
Gametes are____ They have_____ the number of chromosomes.<br> hanloid: double half the
Gnesinka [82]

Answer:

b

Explanation:

gametes are a haploid which means half. so it would be half the chromosome number.

6 0
3 years ago
Read 2 more answers
Jellyfish are a part of Phylum _______.
Anika [276]
Then answer is b. Cnidaria
4 0
3 years ago
When NADH passes its electrons into the Electron Transport System, NADH is chemically:
erik [133]

Answer:

Option D, oxidized

Explanation:

The NADH gets oxidised when it passes its electrons into the Electron Transport System

Oxidization is a process in which one element or compound loses its electron to other chemical element or compound thereby itself getting oxidised and reducing the other one (the one who gains the electron).

Here in the electron transport system, the NADH loses or donates its electron to the Electron Transport System thus chemically it gets oxidized.

Hence, option D is correct

8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Plant fiber is a type of collenchyma cell.<br><br> True<br> False
    7·1 answer
  • Human actions cannot change Earth’s atmosphere. true or false? with explaining please I will award brainiest
    6·1 answer
  • What is a type of enegry food coal oil or light​
    6·1 answer
  • Many plants have thorns on their stems or leaves. What is the MOST likely explanation for the evolution of thorns?
    5·2 answers
  • some of the epithelial cells are folded or wrinkled what does this tell you about the thickness of the cells?
    12·2 answers
  • Processes involved when an eye views an object<br>​
    12·1 answer
  • Which describes the notation Tt for the trait of being tall?
    14·2 answers
  • At each ______ foramen, the dura mater extends between adjacent vertebrae and fuses with the connective tissue layers that surro
    11·1 answer
  • Three factors that influence natural selection are?
    12·1 answer
  • 1) What determines which
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!