1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren2701 [21]
3 years ago
15

In your own words, what is the definition for Chitin? what purpose does chitin serve?

Biology
1 answer:
lidiya [134]3 years ago
8 0

Answer:

Chitin is a fibrous material made up of polysaccharides that is found in the exoskeletons of arthropods and the cell walls of fungus. Chitin is an important biopolymer found in nature. Fungi, arthropods, and nematodes are the principal producers. In insects, it acts as a scaffold, supporting the epidermis and trachea cuticles, as well as the peritrophic matrices that line the gut epithelium.

Explanation:

Hope this helps!

Please mark me as Brainlinieast.

You might be interested in
How did the Mafia gain the interest and scrutiny of the public?
mihalych1998 [28]

Mafia gain the interest and scrutiny of the public through their unique and fearful actions.

Mafia gain the interest and scrutiny of the public by threatening people in the society as well as killing some of them. The main aim of Mafia is to earn money so they perform many actions in order to gain money from the public such as extortion, kidnapping etc.

The person who gives money to Mafia is safe but that person who refuses to pay money to Mafia will gain the punishment of death so we can say that in this way Mafia gain the interest of the public.

Learn more about Mafia here: brainly.com/question/6025116

Learn more: brainly.com/question/26048379

8 0
2 years ago
Where is found mitochondria?
Alina [70]
Mitochondria are found in all body cells.
7 0
3 years ago
Read 2 more answers
Why do fuel prices increase
mel-nik [20]
It depends on where the fuel source is coming from and also how much fuel is there.
5 0
3 years ago
Read 2 more answers
Fungi have saprophytic nutrition. But, what is it exactly? How does it work?
Sloan [31]
Saphrophytic nutrition is all about obtaining nutrients from non-living organic matter, usually dead and decaying plant or animal matter, by absorbing soluble organic compounds.
3 0
3 years ago
Electricity is defined as
fiasKO [112]

Answer:

c. flow of electrons.

Explanation:

thanks

3 0
3 years ago
Read 2 more answers
Other questions:
  • Metamorphic rock ____.
    5·1 answer
  • Is lipids a micronutrients
    11·1 answer
  • How many NADH molecules are produced on each turn of the citric acid cycle?
    15·1 answer
  • Which of the following led to the discovery of cells?
    10·1 answer
  • What a pancreas used for
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • It is common knowledge that elephants are deathly afraid of mice. What is not so common knowledge is the reason why. Clearly it
    9·1 answer
  • Where would a frameshift mutation cause the most damage?
    8·1 answer
  • What types of rocks do the numbers 2, 3, and 5 represent, in that order?
    8·2 answers
  • Are the organisms that others gave the same name to as your group did ?give examples
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!