1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
icang [17]
3 years ago
5

What is the xylem? And what is the function of the xylem for grade 8's? (Please make it simplified)

Biology
1 answer:
ivolga24 [154]3 years ago
8 0
The main function of xylem is to transport water, and some soluble nutrients including minerals and inorganic ions, upwards from the roots to the rest of the plant. Xylem cells form long tubes that transport materials, and the mixture of water and nutrients that flows through the xylem cells is called xylem sap.
You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
What statement is true of all living organisms?
BabaBlast [244]
They grow and develop
7 0
4 years ago
Why do vertebrates have vertebrae instead of just having one long backbone?
Anarel [89]

Answer:

so we can move our back and be flexible

Explanation:

brainliest?

6 0
2 years ago
In developing countries, which of the following is predicted to happen to both population and demand for meat and milk?
lora16 [44]
Number c is the answer
5 0
3 years ago
The complex structures of DNA and protein found in the cell nucleus are mitochondria. nucleoplasm. histones. nucleases. chromoso
mario62 [17]

Answer:

chromosomes

Explanation:

Genomics refers to the scientific study of genes (DNA) found in living organisms such as humans and animals.

A genome can be defined as the complete set of hereditary instructions that is typically found in the deoxyribonucleic acid (DNA).

The complex structures of deoxyribonucleic acid (DNA) and protein found in the cell nucleus are generally referred to as chromosomes.

In sexual reproduction, the chromosomes from parents are found in the cell nucleus and are comprised of deoxyribonucleic acid (DNA), histone proteins, etc. Thus, they are used to store genetic informations in living organisms.

Basically, the human somatic cell is made up of 46 chromosomes which are sub-divided into 22 pairs of autosomes and a pair of sex chromosomes (X and Y). An autosome is one of the numbered chromosome that is typically not a sex chromosome.

On the other hand, sex chromosomes (X and Y) are responsible for determining the gender or sex of living organisms such as humans.

5 0
3 years ago
Other questions:
  • What is the chemical equation of lactic acid fermentation?
    7·1 answer
  • When two or more bones meet, it is known as a(n) _______.
    12·1 answer
  • What would happed to the amount and size of sediment carried by a stream if the velocity of the stream increased
    7·2 answers
  • What is the most likely reason that horses and mountain goat have hooves
    12·2 answers
  • Write a claim, evidence, and a reason. About What is the relationship between photosynthesis and cellar respiration
    11·1 answer
  • what is found in the nucleus and contains genetic information that is passed from generation to generation
    14·1 answer
  • How does your body know it needs to release more bile and pancreatic juices into the small
    9·1 answer
  • Which of the following is the correct order for the major parts of the gastrointestinal tract?
    10·1 answer
  • In the cell membrane, the molecules which move large molecules into and
    6·1 answer
  • Which choice best describes when a cell becomes 2n?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!