1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melisa1 [442]
3 years ago
7

Boyd files a suit in a federal district court against Cathy. Cathy loses the suit, appeals to the U.S. Court of Appeals for the

Second Circuit, and loses again. Cathy asks the United States Supreme Court to hear the case. The Court is
Law
1 answer:
ikadub [295]3 years ago
4 0

Answer:

not required to hear the case.

Explanation:

The United States Court of Appeals  is also known as the circuit courts that are the intermediate appellate courts. The US courts of appeals are one of the most powerful as well influential courts in America.

In the context, Boyd flies a case against Cathy in the federal district court where Cathy loses the case. She then makes an appeal to the circuit courts or the United States Court of Appeals for a second circuit but she loses again. Now if Cathy moves to the Supreme Court of the U.S. and makes an appeal, the Supreme Court is not required to hear Cathy's case as she already made an appeal in the Court of Appeals of U.S. and The court has made his judgement.

You might be interested in
Rank the three types of deposits that savers make at banks from the "highest return" to "lowest return."
german

Answer:

From the question given, they are Check-able deposits,  Savings  and Time

Explanation:

<em>The three types or forms of deposits that savers make at banks from the highest return to the lowest return are as follows,</em>

<em>Check-able deposits, Savings, and time</em>

<em>Check-able deposits: is referred to as a  checking account, were  deposit account held at a financial institution that allows deposit and withdrawals or it is made of any request store account against which draft or checks of any kind might be composed.</em>

<em>Savings: These are income that are not spent by customers or deposit account held at a retail bank that pays premium yet can't be used specifically as cash in the  feeling of a medium of trade. </em>

<em>Time: It can be defined as a deposit in a financial balance that can't be taken back for which notice of withdrawal is required or before a set date.</em>

8 0
3 years ago
Read 2 more answers
26. Name two ways that the work of the president’s cabinet affects how the government runs.
alisha [4.7K]
Djdndjdijdjdie juensudhbejdh udbehdunejdjjd
5 0
3 years ago
If you start feel sleepy when driving you what should you do?
irina [24]
Go to the nearest rest stop.
4 0
3 years ago
Which service do states provide with their tax revenues?
Greeley [361]

Answer:

police protection, education, highway building and maintenance, welfare programs, and hospital and health care.

4 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • The Probable Cause Panel of FREC acts as a grand jury. They determine if there is a law violation or not and they recommend whet
    15·1 answer
  • Jerry, age 23, a full-time student and not disabled, lives with william and sheila carson. jerry is william’s older brother. jer
    8·1 answer
  • Define communism(by experience or by own perspective)​
    7·1 answer
  • If you are married and your partner commits a crime, what is your responsibility as a witness in the trial of your husband or wi
    10·1 answer
  • During a criminal trial, lawyers use their opening statements in order to:
    15·1 answer
  • To what extent has law reform been effective in dealing with discrimination in the workplace?
    7·1 answer
  • The house agreed to the compromise as soon as the senate approved it
    15·1 answer
  • How do the system of checks and balances work ? ( at least two checks /balances for each brand , with real-world example/current
    14·1 answer
  • How learning new things can be turned into an opportunity ​
    12·1 answer
  • why does the Republican party rely on him so heavily? Why does the news cover him so closely? He technically can’t offer anythin
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!