1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergij07 [2.7K]
2 years ago
5

If a DNA molecule is made up of 14% Thymine, theoretically, what percentage would be made up of Guanine?

Biology
1 answer:
garik1379 [7]2 years ago
6 0

Answer:

I expect to find

Explanation:

A=30% C= 20% T = 36% G=14%

You might be interested in
Which of the following scenarios is representative of mutualism?
ycow [4]

<span>The correct answer is B. Bees pollinating flowers.</span>

<span>
In biology, mutualism is how two different organisms survive upon the activity of the other. Each benefits from the mutual relationship. In the case of bees pollinating flowers, both the bees and the flowers need something and benefit from the interaction with the other. </span>

8 0
3 years ago
Read 2 more answers
Do you think molecules are larger or smaller than a cell in the human body?
JulsSmile [24]

Answer:

Yet you can turn up the magnification for an even closer look: Cells contain molecules that are made up of even smaller components called atoms. Figure 1: Levels of the body from smallest to largest: Atoms, molecules, cells, tissues, organs, and organ systems.

3 0
2 years ago
Which obsevation could lead to the conclusion that an object is nonliving <br>​
anastassius [24]
If the object doesn’t contain carbon. All living things contain carbon in some way. Except monoxide, dioxide, carbides, and carbonates
6 0
3 years ago
A student preparing for a hike wants to pack a snack that has biomolecules that provide quickly available Energy but few excess
Valentin [98]

Answer:d

Explanation:

3 0
3 years ago
Which of the following is a key a function of the glial cells?
Evgen [1.6K]
They are thus known as the "supporting cells" of the nervous system. The four main functions of glial cells are: to surround neurons and hold them in place, to supply nutrients and oxygen to neurons, to insulate one neuron from another, and to destroy and remove the carcasses of dead neurons (clean up).
3 0
3 years ago
Other questions:
  • Height and eye colors are two examples of continuous variation in humans, whereas in pea plants the tall allele is dominant over
    11·1 answer
  • What do you think could be done to reduce levels of carbon dioxide in the atmosphere?
    6·1 answer
  • A person sees a ball and kicks it, in part because of actions of the nervous system. Using the parts of the nervous system liste
    12·1 answer
  • Earths outer layer if we consider physical properties and not chemistry is what
    7·1 answer
  • A 60-year-old client tearfully explains to the nurse how her husband downplays her frequent migraines and tells her that she nee
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How dose light intensity affect the rate of photosynthesis
    10·2 answers
  • Which of the following statements describes how muscles help maintain homeostasis?
    12·1 answer
  • For an ecological study, you monitor herbivore-plant interactions in a rainforest and notice that mammalian herbivores avoid the
    9·1 answer
  • an electric car uses a battery to make the car move. what kind of energy transition is happening in the car?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!