How does structure of dna relate to the process of replication and protein synthesis?

1 answer:

4 0

Hello Sophia,
The structure of DNA relates to the process of replication and protein synthesis actually in many ways. DNA is a nucleus acid, one of the 4 major macromolecules (polymers). It provides the instructions for making proteins. When DNA replicates, one strand is used as a template for DNA polymerase to joint corresponding nitrogenous bases. Small, individual sections of the DNA are called genes, which code for a specific protein. STRUCTURE ALWAYS DETERMINES FUNCTION! Thus, DNA tells the cells which amino acids (building blocks of proteins) and in what order for the ribosomes (found in the cytoplasm) to synthesize. These proteins then determine our traits and characteristics. It may be more than you need, but hopefully it helps somewhat. Great question, though! Biology is so interesting, when you think about it! It makes our world and our selves.

You might be interested in

Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC

Cloud [144]

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

4 0

3 years ago

When a pinecone is open, it disperses its seeds. Based on your experiment, can you tell what weather conditions are needed for p

ExtremeBDS [4]

Answer:

If a pine seed finds the right micro-climate, it will eventually sprout and a pine seedling will start to grow. However, pine seeds are usually released in a dormant state, which is most often broken by cold stratification. As a result, a pine seed will not sprout until the following spring when warm weather and some spring moisture are present.

Explanation:

hope it helps

3 0

4 years ago

Which evidence supports the endosymbiotic theory? Select all that apply. Mitochondria and chloroplasts have a separate, simpler

ExtremeBDS [4]

All of the above answers support the endosymbiotic theory in some way

5 0

3 years ago

Read 2 more answers

How does biodiversity affect an ecosystem's ability to stabilize when its climate changes?

konstantin123 [22]

Answer:

Biologically diverse communities are also more likely to contain species that confer resilience to that ecosystem because as a community accumulates species, there is a higher chance of any one of them having traits that enable them to adapt to a changing environment.

Explanation:

Hope it helpsssss!!1

Marke mr brainlist plzzzzzzzzzzzzzzz

3 0

3 years ago

Is the resemblance between timber wolves and tasmanian wolves the result of common ancestry

Harlamova29_29 [7]

Answer:

Yes

Explanation:

Homologous structures or similar structural features can be a result of common ancestry. DNA comparison and analysis between the species can be used to identify the common ancestor.

7 0

3 years ago