We know that oil floats on water and do not mix
<span>
What happens to the oil when you first pour it in? It flows into the water, but then seperates.
Why does this happen? oil is lighter than water and the molecules of the oil are attracted to the other oil molecules, not water, the water molecules the same
What kinds of animals would be most affected by an oil spill at the beginning? animals that live their lives near the surface of the ocean. Why? because now the water that was clear and free-flowing is now dark and sticky. oil also changes the way how some animals survive so make their ways less effective. one example are birds like pelicans
Use a spoon to stir the oil for 30 seconds.
Answer the following questions:
What natural action stirs the real ocean? ocean currents caused by wind and the earth's roation
What happened to the oil? went back to the top
Even if you can’t see it, is all the oil still in your ocean? yes
Which animals in the ocean become affected after wave and current
action causes some of the oil to settle to the bottom, or be absorbed
into the water? bottom-feeders
Add a splash of dish detergent to the mixture and stir.
Answer the following questions:
What happened to the oil? it mixed with the water Is it all still in the ocean? yes
Sometimes cleanup efforts involve dumping a soap mixture over a spill area. Why is this done? to bond the oil to the detergent and the detergent to the water. so they can grab all the oil
What might be a negative effect of dumping the soap?</span> soap has chemicals that could upset the ballance of the ecosystem and kil some animals/plants
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
E-cool is a bacterium that occurs naturally in the intestines of people and animals
