1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Greeley [361]
3 years ago
5

What type of cells are produced by mitosis?

Biology
2 answers:
Lynna [10]3 years ago
5 0
Cells that are produced by mitosis are genetically identical to parent cells. Sex cells are created through meiosis.
masya89 [10]3 years ago
3 0
The cells that are produced by mitosis are sex cells
You might be interested in
In a healthy individual, the strongest respiratory stimulus for breathing is
VashaNatasha [74]
During normal breathing, the brain is stimulated to breath with increasing acidity as a result of CO2 concentration from basic metabolic processes. The brain is quite selfish and only really wants to maintain it's pH which should be at a range of 7.3-7.45, and will not tolerate any decrease. 

In patients who have a chronic respiratory disorder with things like COPD. The brain has become accustomed to excessive acidic content, and is now stimulated by the Hypoxic drive or by low oxygen content. 
3 0
3 years ago
Create an explicit equation for each recursively-defined sequence below.
lbvjy [14]

Answer:

  t(n) = 3·5^(n-1)

Explanation:

The recursive formula describes a sequence in which each term is 5 times the one before it. This is a geometric sequence with common ratio 5 and a first term that is said to be 3.

As you know, the generic formula for a geometric sequence is ...

  an = a1·r^(n-1)

For a1 = 3, r = 5, and a sequence named "t", this is ...

  t(n) = 3·5^(n-1)

5 0
3 years ago
Read 2 more answers
3. Can pure water have colligati e properties?
AleksandrR [38]

Answer: No

Explanation:

the freezing point of salt water is lower than that of pure water, due to the presence of the salt dissolved in the water

7 0
2 years ago
Where are pesticides found in the environment?
Lera25 [3.4K]
It is d because pesticides run off into water, they are absorbed into soil , and they are left in the air , hope this helps :)
7 0
2 years ago
Which of the following is not a means of water erosion?
AysviL [449]
Natural springs hope this helps :D

3 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which of these statements about animal cells and plant cells is true.?
    15·1 answer
  • Milk weed is a common plant found in North America. WhenBroken or cut the plant uses a nutritious snack from Esteban. Maths flie
    6·1 answer
  • Substances effect: partially blocks (H+)/pyruvate symporter, interfering with the transport of pyruvate into the mitochondria. W
    12·1 answer
  • What are 3 things that are not nucleotides in science
    9·2 answers
  • Which are true of electromagnetic waves? Select all that apply.
    7·1 answer
  • from the results of this drug trial suggest which type of drug is the most effective at reducing the risk of heart disease
    15·1 answer
  • The analysis of rRNA gene sequences to compare evolutionary relationships is known as
    5·1 answer
  • each chromosome originally is made of how many DNA molecules and how does this molecule appear in the chromosome
    14·1 answer
  • El hielo flota sobre el agua. Le ocurre igual a un metal sólido sobre su correspondiente fundido?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!