1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lapatulllka [165]
3 years ago
8

Which term describes materials that have large and connected pores, such as sand and gravel

Biology
2 answers:
Kay [80]3 years ago
6 0
The answer is Permeable.\
Serhud [2]3 years ago
5 0
The answer to your question is Permeable
You might be interested in
When are the strong and weak forces active
Bad White [126]

Answer: In the nuclei of atoms

Explanation:

7 0
2 years ago
Ii) TRUE OR FALSE: The warmer the water is, the better it is for developing clams. Support your
Pani-rosa [81]

Answer:

Do you have an data table

7 0
2 years ago
Two heterozygous purple-stemmed plants are grown. Each parent has the genotype ANL/anl. Pollen from one of the plants is used to
patriot [66]

Answer:

A. All of the offspring plants will have purple stems.

Explanation:

All of the offspring plants will have purple stems because both the parents have the same stem color i. e. purple so if they mate with each other , the offspring produce have the same color of stem. Both parents plants are heterozygous which means that they are different from one another in some characteristics but also some similarities such as stem color etc. So all the offspring produce have purple-stemmed.

7 0
3 years ago
Read 2 more answers
What type of cells does a mushroom have?​
zubka84 [21]

A mushroom is a plant, therefore the cell that it has that is different from animal cells would be chloroplasts. However, mushroom also have a specific cells called "fungal cells" which can only be found in mushrooms and fungus.

May I have brainliest please? :)

4 0
2 years ago
A factory is found to be polluting a stream high in the Rocky Mountains. The factory owner says this is not a problem because th
almond37 [142]
Because almost all small streams end up in bigger bodies of water.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which type of pathogenic microbe causes AIDS?
    5·2 answers
  • What is male sex chromosomes
    6·1 answer
  • What types of nitrogen are plants easily able to use
    11·1 answer
  • Do Not Reproduce
    15·1 answer
  • How does the nervous system interact with all other systems
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • There 4 types of connective in the body List the 4 types and then thoroughly explain why these tissues are grouped together as c
    7·1 answer
  • PLEASE HELP!! WILL NAME THE BRANLIEST!!
    14·2 answers
  • How is the skeletal system like a machine
    6·2 answers
  • How does tetanic contraction of muscles help to lift objects heavier than our body weight?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!