1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nadusha1986 [10]
3 years ago
8

I have no idea what this is and I have to turn this in soon pls help

Biology
1 answer:
JulijaS [17]3 years ago
4 0

Answer:

sorry

Explanation:

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
How many different proteins, each composed of 8 amino acids, can be constructed using the 20 different amino acids found in prot
Darina [25.2K]
To solve this, you would need to identify the number of amino acids (20) you are dealing with and the number of positions (8) that are available in your polypeptide. so that would come out to 20 x 20 x 20 x 20 x 20 x 20 x 20 x 20 = 20^8
6 0
3 years ago
Why do some cells have nothing inside of them
SashulF [63]
Cells dont have anything inside because the cells helps us
7 0
3 years ago
What is the species of an animal always written in?
lina2011 [118]
It's written in italics.
8 0
3 years ago
Read 2 more answers
Which patient situation indicates that a patient might be experiencing an increase in his perception of pain
saveliy_v [14]

Answer:

Explanation:

There are some signs and symptoms that a person may exhibit if they are in pain that can clue you in:

Facial grimacing or a frown.

Writhing or constant shifting in bed.

Moaning, groaning, or whimpering.

Restlessness and agitation.

Appearing uneasy and tense, perhaps drawing their legs up or kicking.

3 0
3 years ago
Other questions:
  • Ignore this thx sjshgfkskwka
    10·1 answer
  • Place the following in order from smallest to largest amino acid, globular structure, c,h,o,n
    8·1 answer
  • What type of energy does boiling water use?
    11·1 answer
  • Reabsorption of high levels of glucose and amino acids in the filtrate is accomplished by __________.
    14·1 answer
  • Which virus is correctly matched with its structure?
    9·2 answers
  • How are the reproductive cycles of a fungus and a pteridophyte similar? A. Both organisms form fruiting bodies that produce dipl
    15·2 answers
  • Which measurement is affected by gravity?(1 point)
    6·1 answer
  • Abnormalities in shellfish are common. In one type of abnormality, the DNA of the shellfish contains an extra nitrogen base pair
    6·1 answer
  • Please help!! the sooner the better
    7·1 answer
  • Belovsky, G. E., C. Mellison, C. Larson, and P. A. Van Zandt. 1999. Experimental studies of extinction dynamics. Science 286:117
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!