Answer:
Bog
Explanation:
A type of standing-water habitat in which the soil is acidic and decay is slow is called a <u>bog</u>.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Transcription starts at the template strand of DNA where mRNA attaches and is constructed from 5’ to 3’ direction. The nucleotides of the DNA strand is attached to either A, U, G, C ribosomal nucleotides. mRNA Dissembles when it reaches a terminating codon and then it attaches to ribosomal RNA where tRNA carries the amino and mRNA caries the code to construct proteins with the ribosome.
