1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vesna_86 [32]
2 years ago
8

Which of the following is NOT a type of wetland?

Biology
2 answers:
Natali5045456 [20]2 years ago
5 0
I think it is d because the other places are of course wet lands.
Ksivusya [100]2 years ago
3 0

Explanation:

i have no clue, but good luck, hopefully you pass the test

You might be interested in
Is rust eating a hole in a metal bucket living or nonliving?
Nookie1986 [14]
It is nonliving because it is just more metal, except it is changing.
6 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
A nucleus of an atom is made of protons and what
Alisiya [41]

Answer:

It is made up of protons and neutrons

6 0
2 years ago
Read 2 more answers
About 40 percent of the medicines used in the United States are derived from _____.
tester [92]
The answer would be, "C", "Plants". 
4 0
3 years ago
Read 2 more answers
"Adaptations develop in response to environmental changes. For example, if a human population was displaced into the ocean, even
mel-nik [20]

Answer:

uh Photoperiodism

Explanation:

3 0
2 years ago
Other questions:
  • Plz help!!
    12·2 answers
  • Use what you know about atmospheric circulation and seasonal changes in the sun’s orientation to earth to explain the highly sea
    5·1 answer
  • What is meant by a mechanism of evolution?
    8·1 answer
  • Organisms in this kingdom are multi-celled, cannot move, and get their energy by decomposing dead matter.
    15·1 answer
  • The factor(s) that determine the duration of a twitch in various types of fibers is the speed of the
    12·1 answer
  • What is the process in which the blood vessels that supply the heart muscles are narrowed or closed by the gradual buildup of a
    15·1 answer
  • The American Heart Association recommends eating at least _______ ounces of oily fish per week to help reduce your risk of heart
    11·2 answers
  • "Sunlight is required for plant growth. When light energy is absorbed by a leaf, after a series of chemical reactions, the light
    12·1 answer
  • The parasympathetic division of the autonomic nervous system A. is associated with "fight or flight." B. opposes the effects of
    9·1 answer
  • 3. What determines how many species live in a given place? And, what
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!