1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
13

Which two arguments support loose constructionism?

Law
1 answer:
Anastaziya [24]3 years ago
7 1

Answer:

Loose constructionism is an ideological position of legal interpretation (especially of the Constitution) by means of which the judges have the power not only to judge compliance with the different laws, but also to interpret the text of the legal provisions of the Constitution, defining its scope and content.

Two arguments in favor of this position are, on the one hand, that the Constitution is not a rigid law but that it is constantly being modified through jurisprudential interpretations, with which it is necessary for judges to be able to interpret its clauses in a lax way; and on the other, that a rigid Constitution would be easily set aside by society, since it would not adapt to changes in circumstances on its part.

Bug
2 years ago
SO whats the answer?
You might be interested in
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
FAST PLEASE ANSWER!!!!!
Alenkasestr [34]

Answer:

D.

Explanation:

3 0
3 years ago
Road markings_<br> and<br> _drivers as well as_<br> traffic.
aleksklad [387]

Explanation:

Traffic signals, signs and pavement markings are used for traffic control to provide a smooth, orderly flow of traffic. ... Road markings guide and warn drivers as well as regulate traffic. Markings may be red, blue, yellow or white. They may be used alone or in combinations.

5 0
3 years ago
Who did police originally believe was responsible for the death of Jose and Kitty Menendez?
cluponka [151]

The police originally suspected that the death of Jose and Kitty Menendez resulted from a <u>mob</u>.

<h3>What is a mob?</h3>

A mob can be described as a criminal gang or simply a Mafia.

By its very nature, a mob is a secret organization made up of criminals.

However, after it was reported that the couple was murdered by their own children, Lyle and Erik Menendez, police arrested the duo and the court proceedings lasted several years before they were convicted and incarcerated for life.

Thus, originally, police believed that a mob was responsible for the death of Jose and Kitty Menendez, not suspecting that the couple's children were the culprits.

Learn more about mobs at brainly.com/question/28029513

#SPJ1

7 0
1 year ago
Which theory of crime focuses mostly on how the structure and chemistry of the brain might affect behavior?
Lelechka [254]

Answer:

sociological theories

4 0
3 years ago
Read 2 more answers
Other questions:
  • A following distance greater than 3 seconds is advised when you
    7·1 answer
  • What are two interpretations of the term rule of law, depending on context? (Select all that apply.) Rule of law means that gove
    12·1 answer
  • PLZ ANSWER BOTH QUESTIONS!!!
    7·1 answer
  • Anyone help me maybe i'm dumb<br> What is 7x8x9 + 10x11x12?
    7·2 answers
  • What is the primary purpose of a health maintenance organization (HMO)?
    7·1 answer
  • Using complete sentences, discribe the difference between foreign and domestic issues and provide and example of each.
    5·1 answer
  • In the context of types of corruption in police departments, which of the following
    12·1 answer
  • Would you rather be part of making, enforcing, or interpreting laws? Why?
    6·1 answer
  • During the 1950s, psychology and social psychological research played key roles in the new focus on prisoner's health and well-b
    8·1 answer
  • Evaluate the impact of personal values onthe success of the census campaign
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!