1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scilla [17]
2 years ago
7

Please help me ASAP I’ll mark Brainly

Chemistry
1 answer:
mixer [17]2 years ago
5 0

Answer:

cell

chloroplast and cell wall

nucleus

life processes

cell membrane

shape and size

vacuole

Hope it helps

You might be interested in
What is the mass of phosphorus that contains twice the number of atoms found in 14
yulyashka [42]

Answer:

15.5 gm

Explanation:

What is the mass of phosphorus that contains twice the number of atoms found in 14 g of iron?

[Relative atomic mass : P = 31; Fe = 56]

14 gm Fe = 14gm/ 56 gm/mole = 14 mole gm/56gm = 14/56 mole

0.25 moles

2 X 0.25 = 0.5 moles

1 mole P = 31 gm

so

0.5 moles P =31/2 =15.5 gm

3 0
2 years ago
What is the name of the compound K3N?
alexdok [17]
The name of the compound K3N is potassium nitride (C).
8 0
3 years ago
Read 2 more answers
What is the apparent brightness of a star?
Rzqust [24]

Answer:

it's bright where you can see it it's not that bright compared to the sun from Earth it's really not so bright

3 0
2 years ago
A square painting has a length of 62 cm.<br><br> What is the area of the painting?<br><br> cm²
svetlana [45]

Answer:3844 cm^2

Explanation:

62 squared since it is a square, and area is base times height

3 0
3 years ago
PLEASE HELP ASAP!!!!! WILL GIVE BRAINLIEST!!!!
Akimi4 [234]

Explanation:

The magnet uses electromagnetic induction meaning it can be readily magnetized and demagnetized (using electricity) when required. When electricity is switched on, it becomes magnetized and lifts an object and when electricity is switched off, it loses magnetism and releases the object.

The magnetic is able to lift heavy objects because it has powerful conductor material (ferromagnetic iron) and the number of electromagnetic coils is many to induce a powerful magnetic force. The electric current, inducing the magnetism, is also powerful.

Learn More:

For more on electromagnetic induction check out;

brainly.com/question/3414535

brainly.com/question/13369951

#LearnWithBrainly

7 0
3 years ago
Other questions:
  • N2 + 3H2 2NH3 How many molecules of H2 are in the reaction? molecules How many nitrogen atoms are present? atoms How many moles
    5·1 answer
  • When you weigh yourself on good old terra firma (solid ground), your weight is 151 lb . in an elevator your apparent weight is 1
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Some of the enzymes that oxidize sugars to yield useable cellular energy (for example, ATP) are regulated by phosphorylation. Fo
    13·1 answer
  • A flexible container at an initial volume of 4.11 L contains 6.51 mol of gas. More gas is then added to the container until it r
    11·1 answer
  • What type of reaction is this?<br> A. double replacemment<br> B. Single replacement
    14·1 answer
  • What so ammonia and bleach make
    7·1 answer
  • Which statement is true of the rock cycle?
    8·2 answers
  • HELP HELP!
    6·2 answers
  • A gas mixture contains the following gases with the mole fractions indicated:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!