1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Varvara68 [4.7K]
3 years ago
11

How to invasive plants effect negatively and how does removing them effect is positively

Biology
1 answer:
Anna [14]3 years ago
3 0

Answer:

Invasive plant species have an impact on the diversity of local species, they affect water availability and damage the quality of soil nutrients. Once an alien plant has invaded a habitat, it changes the conditions of that environment. It does so by changing the light, solar radiation and temperature levels in the invaded patches. The quality and availability of food, shelter, nest sites, basking sites and perches are changed for a number of animals.In a few cases, some benefits of alien plants have been reported. For example, they can provide fire wood for local communities or add resources for animal species. But these benefits typically do not surpass the negative effects.

Explanation:

You might be interested in
Sheath of schwann cell containing cytoplasm and nucleus that encloses myelin. True or False
chubhunter [2.5K]

The given question is not about true/false. The correct question is:

Question: Sheath of schwann cell containing cytoplasm and nucleus that encloses myelin.......

Answer:

Neurolemma

Explanation:

Schwann cells are one of the two types of neuroglia that produce myelin sheaths. Schwann cells produce the myelin sheath in the peripheral nervous system. These cells produce the myelin sheaths around axons during fetal development. During the process, several layers of the glial plasma membrane surround the axon. The Schwann cell’s cytoplasm and nucleus form the outermost layer. On the other hand, the inner part is composed of multiple layers of Schwann cell membrane and is called the myelin sheath. The outer nucleated cytoplasmic layer of the Schwann cell that encloses the myelin sheath is called the neurolemma.

5 0
3 years ago
Becky wanted to figure out what type of liquid worked best for growing beans. She watered
Tomtit [17]

Answer:

The one with coca-cola will surely die, the one with lemonade will have trouble, the one with water will be just fine

Explanation:

3 0
3 years ago
You are on the scene in the bad part of town for an unresponsive 18-year-old type 1 diabetic patient. his mother states that he
Margaret [11]
<span>The answer would be: Continue patient care by getting a complete SAMPLE history and perform a complete secondary assessment.

If the reading of glucose test is normal, then you can exclude hypoglycemia from the possible diagnosis. Because the patient is accompanied by his mother, you can ask a brief history to exclude other possible diagnosis and complete secondary assessment before further help comes. The information would be beneficial to the healthcare personnel that will comes for help.
</span>
8 0
3 years ago
Which of the following is an ethical question?
Elina [12.6K]
C. Ethics deals with patient rights
8 0
2 years ago
Explain how restriction enzyme digestion results would change if
emmainna [20.7K]

Answer:

The foreign gene might be lost

Explanation:

Restriction enzymes have two properties useful in recombinant DNA technology.They cut DNA into fragments of a size suitable for cloning at palindromic sites. Many restriction enzymes make staggered cuts that create single-stranded sticky ends conducive to the formation of recombinant DNA. The foreign might be cleaved and removed from the plasmid. plasmid is an extrachromosomal strand in bacteria.

7 0
3 years ago
Other questions:
  • Why did Clara Barton form the American Red Cross
    5·1 answer
  • Which term names the area between Mars and Jupiter?
    8·1 answer
  • What surrounds all cells?​
    11·1 answer
  • BRAINLIEST AND ALL FOR ANSWERING!!!!!
    7·2 answers
  • An experimental design was set up by biology students to observe cellular respiration by aerobic bacteria in a closed culture. A
    6·2 answers
  • Reefs grow best in _______.
    13·2 answers
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • What type of cells are humans made from? Plant Cell or Animal Cell
    9·1 answer
  • HELP ME OUT PLEASE
    5·1 answer
  • Which material from the table is a liquid at 50c and a gas at 300c
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!