The process of dissolving two organic molecules in a polymer and recombining the water molecules to create new monomers is known as hydrolysis.
<h3>What is hydrolysis?</h3>
The molecule is broken in a hydrolysis reaction involving an ester bond, such as the one between two amino acids in a protein. As a result, the water molecule (H₂O) splits into two groups: one that forms a hydroxyl (OH) group with the remaining hydrogen proton (H+) and another that transforms into a carboxylic acid.
Practically speaking, hydrolysis refers to the process of separating compounds when water is present.
Condensation, which is the process by which two molecules combine to produce one bigger molecule, can also be thought of as the opposite reaction to hydrolysis. The outcome of this reaction is that a water molecule is ejected by the larger molecule.
The three primary hydrolysis processes are
- Acid hydrolysis.
- Base hydrolysis.
To know more hydrolysis visit
brainly.com/question/11461355
#SPJ4
Answer:
Plants are mainly multicellular, predominantly photosynthetic eukaryotes of the kingdom Plantae. Historically, plants were treated as one of two kingdoms including all living things that were not animals, and all algae and fungi were treated as plants.
Answer:
Genotypic ratio of offsprings will be: 1 (Hh) : 1 (hh)
Explanation:
This question involves a single gene coding for the possession or not of Hitchhiker's thumb in humans. The allele that codes for Hitchhiker's thumb (H) is dominant over the allele for no hitchhiker's thumb (h).
Based on this question, if woman who does not have hitchhiker's thumb (hh) marries a man who is heterozygous for hitchhiker's thumb (Hh) i.e. hh × Hh, the following gametes will be produced by each parent:
hh - h and h
Hh - H and h
Using these gametes in a punnet square (see attached image), the offsprings with the following genotypic ratio will be likely produced:
1 (Hh) : 1 (hh)
N.B:
- Two (2) of them were Hh i.e. with Hitchhiker's thumb
- The other two were hh i.e. no hitchhiker's thumb.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
