1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Airida [17]
3 years ago
9

PLEASE HELP ME !!!

Biology
1 answer:
Juli2301 [7.4K]3 years ago
5 0

Answer:

4

Explanation:

You might be interested in
The splitting apart of two organic molecules in a polymer and adding back the water parts to make individual monomers again is c
Pani-rosa [81]

The process of dissolving two organic molecules in a polymer and recombining the water molecules to create new monomers is known as hydrolysis.

<h3>What is hydrolysis?</h3>

The molecule is broken in a hydrolysis reaction involving an ester bond, such as the one between two amino acids in a protein. As a result, the water molecule (H₂O) splits into two groups: one that forms a hydroxyl (OH) group with the remaining hydrogen proton (H+) and another that transforms into a carboxylic acid.

Practically speaking, hydrolysis refers to the process of separating compounds when water is present.

Condensation, which is the process by which two molecules combine to produce one bigger molecule, can also be thought of as the opposite reaction to hydrolysis. The outcome of this reaction is that a water molecule is ejected by the larger molecule.

The three primary hydrolysis processes are

  • Salt hydrolysis.
  • Acid hydrolysis.
  • Base hydrolysis.

To know more hydrolysis visit

brainly.com/question/11461355

#SPJ4

4 0
2 years ago
Write things abaot the classification of plant ?
azamat

Answer:

Plants are mainly multicellular, predominantly photosynthetic eukaryotes of the kingdom Plantae. Historically, plants were treated as one of two kingdoms including all living things that were not animals, and all algae and fungi were treated as plants.

3 0
3 years ago
Read 2 more answers
Which organisms have the most energy available to them?
slava [35]

Answer:

primary consumers

Explanation:

7 0
3 years ago
Read 2 more answers
Hitchhiker's thumb (H) is dominant to no hitchhiker's thumb (h). A woman who does not have hitchhiker's thumb marries a man who
kakasveta [241]

Answer:

Genotypic ratio of offsprings will be: 1 (Hh) : 1 (hh)

Explanation:

This question involves a single gene coding for the possession or not of Hitchhiker's thumb in humans. The allele that codes for Hitchhiker's thumb (H) is dominant over the allele for no hitchhiker's thumb (h).

Based on this question, if woman who does not have hitchhiker's thumb (hh) marries a man who is heterozygous for hitchhiker's thumb (Hh) i.e. hh × Hh, the following gametes will be produced by each parent:

hh - h and h

Hh - H and h

Using these gametes in a punnet square (see attached image), the offsprings with the following genotypic ratio will be likely produced:

1 (Hh) : 1 (hh)

N.B:

- Two (2) of them were Hh i.e. with Hitchhiker's thumb

- The other two were hh i.e. no hitchhiker's thumb.

5 0
3 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Other questions:
  • How do bacteria get food and energy
    8·1 answer
  • which is an example of an acquired trait? A the ability to hear B the ability to write C color vision D body hair
    15·2 answers
  • What is bigger a monosaccharide or a disaccharide
    15·2 answers
  • Most molecular biologists think that viruses originated from fragments of cellular nucleic acid. Which of the following observat
    12·2 answers
  • What can happen when the earth's plates slide past each other?
    13·2 answers
  • When coral animals die, their skeletons fall to the sea floor. true or false
    6·2 answers
  • A segment of DNA is called a (n)?
    9·1 answer
  • 1.Why do organisms do Meiosis?
    6·2 answers
  • Which of the following characteristics of Figure 1 best shows that the fragment is RNA and not DNA ?
    6·1 answer
  • A segment of mRNA has the sequence UGACAUAGC. Which of the following would represent the
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!