1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brrunno [24]
3 years ago
12

Why is natural selection not random

Biology
1 answer:
Ira Lisetskai [31]3 years ago
3 0

Answer:

The survival and reproductive success of an individual is directly related to the ways it's inherited traits function in the context of its local environment

Hope this helps

You might be interested in
Is a type of cell division that produces gametes.
Mila [183]

Answer:

Meiosis is a type of cell division that produces gametes.

Explanation:

Gametes are haploid cells, and each cell carries only one copy of each chromosome. These reproductive cells are produced through a type of cell division called meiosis.

6 0
3 years ago
Read 2 more answers
Chloroplasts are involved with transfering the potential energy in glucose into ATP molecules
sdas [7]

Answer:False

Explanation:

3 0
3 years ago
Read 2 more answers
Geologist James Hutton argued that the geologic processes occurring today have occurred since the formation of Earth. This idea
-BARSIC- [3]
D I think not too sure tho

6 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Describe how fossils help us understand the past
stepan [7]
<span><em>They tell us how life evolved and adapted to different environments and global changes throughout the Earth's development</em>

<em>                                Hope this helps:)</em>





</span>
7 0
3 years ago
Other questions:
  • Where is ATP synthase located in the mitochondrion?
    14·1 answer
  • DNA contains all of the genetic information for a cell and is often called?
    13·2 answers
  • Which actions can be taken to plan for a drought? Check all that apply.
    11·2 answers
  • During middle childhood, __________ medical conditions are common and __________ medical conditions are rare.
    11·1 answer
  • Which is a part of the cell theory?
    9·2 answers
  • True or False: Alex used her fingers to remove the lid from a can of vegetables after he opened it with a can opener. Sophia kno
    13·1 answer
  • What is the color spectrum?
    5·2 answers
  • Nuclear hormone receptors form a complex with their ligands, other proteins, and DNA control elements in order to regulate the e
    13·1 answer
  • Does anyone have the answer key to the "muscles and bones gizmo student exploration"?
    13·1 answer
  • Please help I am so far behind Omar is researching and taking notes to write a biography about George Washington Carver. What ca
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!