A zygote is the result of the formation between the two sex cells (ovum and sperm).
Answer:
I think the answer the cell membrane, the nucleus, the cytoplasm, not sure 100%
In my deffinition for other questions:
Trait: a genetically determined characteristic.
DNA you should add what is that stand for: Deoxyribonucleic acid
4 possibles protein bases include: adenine (A), cytosine (C), guanine (G), and thymine (T)
Hope this still help :3
the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'
the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand
so for reference heres a little cheat guide
Adenine=Thymine
Thymine=Adenine
Guanine=Cytosine
Cytosine=Guanine